Incidental Mutation 'R7622:Olfr1112'
ID589178
Institutional Source Beutler Lab
Gene Symbol Olfr1112
Ensembl Gene ENSMUSG00000044487
Gene Nameolfactory receptor 1112
SynonymsGA_x6K02T2Q125-48676316-48677272, MOR264-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7622 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87187798-87192767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87192250 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 188 (I188L)
Ref Sequence ENSEMBL: ENSMUSP00000149960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053050] [ENSMUST00000216772]
Predicted Effect probably benign
Transcript: ENSMUST00000053050
AA Change: I188L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000052341
Gene: ENSMUSG00000044487
AA Change: I188L

DomainStartEndE-ValueType
Pfam:7tm_4 38 315 2.4e-52 PFAM
Pfam:7tm_1 48 297 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216772
AA Change: I188L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,948,413 C1502* probably null Het
Adgrd1 G A 5: 129,139,624 D384N probably benign Het
Aqp8 T C 7: 123,466,660 F226S possibly damaging Het
Arl6ip6 A G 2: 53,217,327 Y207C probably damaging Het
Cbfa2t2 A G 2: 154,500,445 E27G possibly damaging Het
Cdc42bpb T G 12: 111,294,772 E201A unknown Het
Cfap54 A C 10: 92,956,944 V1769G unknown Het
Dmxl2 C T 9: 54,472,218 G7S probably damaging Het
Dnah6 G T 6: 73,124,759 F1927L possibly damaging Het
Dnajc6 A G 4: 101,640,491 E942G probably damaging Het
Fam170a A G 18: 50,282,902 R324G probably benign Het
Gapdhs G A 7: 30,739,331 T9I unknown Het
Gm10320 T A 13: 98,489,724 R51* probably null Het
Gm19410 A T 8: 35,810,347 T1776S possibly damaging Het
Gm4846 A T 1: 166,495,872 M94K possibly damaging Het
Ighv2-5 G A 12: 113,685,738 Q32* probably null Het
Klc2 T C 19: 5,111,632 E310G probably damaging Het
Krt75 A G 15: 101,570,272 M309T probably damaging Het
Lrp11 G A 10: 7,590,172 G41R unknown Het
Lrrc52 G T 1: 167,466,095 P207Q probably benign Het
Lrrc52 G T 1: 167,466,096 P207T probably benign Het
Lrrk2 A T 15: 91,812,323 D2438V probably damaging Het
Mycbp C T 4: 123,905,301 T28M probably damaging Het
Myh14 A G 7: 44,632,422 V804A probably benign Het
Myo16 A G 8: 10,376,238 I332V unknown Het
Ncor1 G T 11: 62,317,968 Q1359K probably benign Het
Olfr1055 A G 2: 86,347,662 Y35H possibly damaging Het
Olfr50 A G 2: 36,793,931 K232E probably benign Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Oog3 T C 4: 144,158,319 D349G probably benign Het
Pate4 A G 9: 35,608,299 S32P possibly damaging Het
Pcdhb7 A C 18: 37,342,461 S217R probably benign Het
Pde1c G A 6: 56,126,925 R580C probably damaging Het
Pi4ka C A 16: 17,293,977 A1545S Het
Pign G T 1: 105,648,117 T266K possibly damaging Het
Pitpnm2 A G 5: 124,122,027 I1134T probably benign Het
Ppfia2 G A 10: 106,830,659 V409I possibly damaging Het
Prr7 A G 13: 55,472,796 T206A probably benign Het
Rnf13 A T 3: 57,820,534 R212* probably null Het
Rwdd2b T C 16: 87,434,612 N218S probably benign Het
Serpina3m A G 12: 104,389,575 D167G possibly damaging Het
Slit2 A T 5: 47,985,205 N56Y probably damaging Het
Sprr3 G T 3: 92,457,285 T84K probably damaging Het
Stab2 A T 10: 86,873,902 H1626Q possibly damaging Het
Tex2 C A 11: 106,546,895 D650Y unknown Het
Tmprss6 A G 15: 78,446,726 S436P probably benign Het
Uba2 A C 7: 34,165,435 F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 S242L probably damaging Het
Vmn1r86 T G 7: 13,102,758 I64L probably benign Het
Vmn2r67 A T 7: 85,136,454 V781E probably damaging Het
Vmn2r80 T A 10: 79,194,263 F641Y probably damaging Het
Wdfy4 A T 14: 33,078,274 I1965K Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Wdr90 G T 17: 25,854,109 F837L probably benign Het
Xpo4 A G 14: 57,597,011 V704A possibly damaging Het
Zc3h12d A G 10: 7,867,269 K268E probably damaging Het
Other mutations in Olfr1112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Olfr1112 APN 2 87191848 missense probably benign 0.00
R0665:Olfr1112 UTSW 2 87192308 missense probably damaging 1.00
R1698:Olfr1112 UTSW 2 87191737 missense probably benign 0.00
R1717:Olfr1112 UTSW 2 87191903 missense probably benign 0.38
R1768:Olfr1112 UTSW 2 87191698 missense probably benign
R1872:Olfr1112 UTSW 2 87191878 missense possibly damaging 0.96
R3441:Olfr1112 UTSW 2 87191818 missense probably benign 0.00
R4017:Olfr1112 UTSW 2 87192502 missense probably benign 0.03
R4895:Olfr1112 UTSW 2 87191848 missense probably benign 0.00
R5451:Olfr1112 UTSW 2 87192452 missense probably damaging 1.00
R6171:Olfr1112 UTSW 2 87192365 missense possibly damaging 0.77
R6851:Olfr1112 UTSW 2 87192469 missense probably benign 0.37
R7263:Olfr1112 UTSW 2 87192132 nonsense probably null
R7659:Olfr1112 UTSW 2 87192365 missense possibly damaging 0.77
R7798:Olfr1112 UTSW 2 87192292 missense probably benign 0.00
R7880:Olfr1112 UTSW 2 87192090 nonsense probably null
R7963:Olfr1112 UTSW 2 87192090 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGCCACTGAGTGCTTTATTC -3'
(R):5'- CATGTAGAGAAGGCCTTGGCTC -3'

Sequencing Primer
(F):5'- ACGGCTATGGCTTATGACAG -3'
(R):5'- TCTCCCAGTTGCAGATGGAAG -3'
Posted On2019-10-24