Incidental Mutation 'R7622:Dnajc6'
ID589184
Institutional Source Beutler Lab
Gene Symbol Dnajc6
Ensembl Gene ENSMUSG00000028528
Gene NameDnaJ heat shock protein family (Hsp40) member C6
Synonymsauxilin, 2810027M23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7622 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location101496648-101642799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101640491 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 942 (E942G)
Ref Sequence ENSEMBL: ENSMUSP00000102546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038207] [ENSMUST00000094953] [ENSMUST00000106929] [ENSMUST00000106930] [ENSMUST00000106933]
Predicted Effect probably damaging
Transcript: ENSMUST00000038207
AA Change: E912G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044251
Gene: ENSMUSG00000028528
AA Change: E912G

DomainStartEndE-ValueType
SCOP:d1d5ra2 88 244 1e-20 SMART
PTEN_C2 251 390 5.95e-42 SMART
low complexity region 502 521 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
DnaJ 873 934 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094953
AA Change: E874G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092560
Gene: ENSMUSG00000028528
AA Change: E874G

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106929
AA Change: E874G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102542
Gene: ENSMUSG00000028528
AA Change: E874G

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106930
AA Change: E874G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102543
Gene: ENSMUSG00000028528
AA Change: E874G

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106933
AA Change: E942G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102546
Gene: ENSMUSG00000028528
AA Change: E942G

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
SCOP:d1d5ra2 118 274 1e-20 SMART
PTEN_C2 281 420 5.95e-42 SMART
low complexity region 532 551 N/A INTRINSIC
low complexity region 584 599 N/A INTRINSIC
low complexity region 709 724 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
DnaJ 903 964 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous and heterozygous for a knock-out allele exhibit postnatal lethality and decreased body weight with homozygotes exhibiting decreased synpatic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,948,413 C1502* probably null Het
Adgrd1 G A 5: 129,139,624 D384N probably benign Het
Aqp8 T C 7: 123,466,660 F226S possibly damaging Het
Arl6ip6 A G 2: 53,217,327 Y207C probably damaging Het
Cbfa2t2 A G 2: 154,500,445 E27G possibly damaging Het
Cdc42bpb T G 12: 111,294,772 E201A unknown Het
Cfap54 A C 10: 92,956,944 V1769G unknown Het
Dmxl2 C T 9: 54,472,218 G7S probably damaging Het
Dnah6 G T 6: 73,124,759 F1927L possibly damaging Het
Fam170a A G 18: 50,282,902 R324G probably benign Het
Gapdhs G A 7: 30,739,331 T9I unknown Het
Gm10320 T A 13: 98,489,724 R51* probably null Het
Gm19410 A T 8: 35,810,347 T1776S possibly damaging Het
Gm4846 A T 1: 166,495,872 M94K possibly damaging Het
Ighv2-5 G A 12: 113,685,738 Q32* probably null Het
Klc2 T C 19: 5,111,632 E310G probably damaging Het
Krt75 A G 15: 101,570,272 M309T probably damaging Het
Lrp11 G A 10: 7,590,172 G41R unknown Het
Lrrc52 G T 1: 167,466,095 P207Q probably benign Het
Lrrc52 G T 1: 167,466,096 P207T probably benign Het
Lrrk2 A T 15: 91,812,323 D2438V probably damaging Het
Mycbp C T 4: 123,905,301 T28M probably damaging Het
Myh14 A G 7: 44,632,422 V804A probably benign Het
Myo16 A G 8: 10,376,238 I332V unknown Het
Ncor1 G T 11: 62,317,968 Q1359K probably benign Het
Olfr1055 A G 2: 86,347,662 Y35H possibly damaging Het
Olfr1112 A T 2: 87,192,250 I188L probably benign Het
Olfr50 A G 2: 36,793,931 K232E probably benign Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Oog3 T C 4: 144,158,319 D349G probably benign Het
Pate4 A G 9: 35,608,299 S32P possibly damaging Het
Pcdhb7 A C 18: 37,342,461 S217R probably benign Het
Pde1c G A 6: 56,126,925 R580C probably damaging Het
Pi4ka C A 16: 17,293,977 A1545S Het
Pign G T 1: 105,648,117 T266K possibly damaging Het
Pitpnm2 A G 5: 124,122,027 I1134T probably benign Het
Ppfia2 G A 10: 106,830,659 V409I possibly damaging Het
Prr7 A G 13: 55,472,796 T206A probably benign Het
Rnf13 A T 3: 57,820,534 R212* probably null Het
Rwdd2b T C 16: 87,434,612 N218S probably benign Het
Serpina3m A G 12: 104,389,575 D167G possibly damaging Het
Slit2 A T 5: 47,985,205 N56Y probably damaging Het
Sprr3 G T 3: 92,457,285 T84K probably damaging Het
Stab2 A T 10: 86,873,902 H1626Q possibly damaging Het
Tex2 C A 11: 106,546,895 D650Y unknown Het
Tmprss6 A G 15: 78,446,726 S436P probably benign Het
Uba2 A C 7: 34,165,435 F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 S242L probably damaging Het
Vmn1r86 T G 7: 13,102,758 I64L probably benign Het
Vmn2r67 A T 7: 85,136,454 V781E probably damaging Het
Vmn2r80 T A 10: 79,194,263 F641Y probably damaging Het
Wdfy4 A T 14: 33,078,274 I1965K Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Wdr90 G T 17: 25,854,109 F837L probably benign Het
Xpo4 A G 14: 57,597,011 V704A possibly damaging Het
Zc3h12d A G 10: 7,867,269 K268E probably damaging Het
Other mutations in Dnajc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dnajc6 APN 4 101508089 intron probably benign
IGL02336:Dnajc6 APN 4 101614286 unclassified probably null
IGL02551:Dnajc6 APN 4 101639353 missense probably damaging 1.00
IGL02801:Dnajc6 APN 4 101597813 missense probably benign 0.33
IGL02887:Dnajc6 APN 4 101639300 missense probably damaging 1.00
IGL03107:Dnajc6 APN 4 101616860 missense probably damaging 1.00
IGL03271:Dnajc6 APN 4 101508077 intron probably benign
R0091:Dnajc6 UTSW 4 101616777 splice site probably benign
R0384:Dnajc6 UTSW 4 101598956 missense probably damaging 1.00
R0546:Dnajc6 UTSW 4 101635191 missense probably damaging 0.99
R0689:Dnajc6 UTSW 4 101611253 missense possibly damaging 0.91
R1239:Dnajc6 UTSW 4 101635116 missense probably damaging 0.98
R1421:Dnajc6 UTSW 4 101611316 missense probably damaging 0.97
R1424:Dnajc6 UTSW 4 101639347 missense possibly damaging 0.92
R1563:Dnajc6 UTSW 4 101599137 missense probably damaging 1.00
R1608:Dnajc6 UTSW 4 101599167 missense probably damaging 1.00
R1757:Dnajc6 UTSW 4 101597831 missense probably damaging 1.00
R1856:Dnajc6 UTSW 4 101598988 missense probably damaging 1.00
R2032:Dnajc6 UTSW 4 101614238 missense probably benign 0.39
R2518:Dnajc6 UTSW 4 101612930 missense probably damaging 0.99
R4028:Dnajc6 UTSW 4 101616857 missense probably damaging 1.00
R4088:Dnajc6 UTSW 4 101639396 missense probably damaging 1.00
R4601:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4602:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4610:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4755:Dnajc6 UTSW 4 101550799 missense probably damaging 1.00
R4878:Dnajc6 UTSW 4 101599034 intron probably benign
R4938:Dnajc6 UTSW 4 101636813 missense probably damaging 1.00
R5373:Dnajc6 UTSW 4 101615627 missense probably damaging 0.99
R5391:Dnajc6 UTSW 4 101628158 critical splice donor site probably null
R5435:Dnajc6 UTSW 4 101606610 missense probably damaging 0.99
R5760:Dnajc6 UTSW 4 101618642 missense probably benign 0.39
R6044:Dnajc6 UTSW 4 101616577 missense probably benign 0.22
R6086:Dnajc6 UTSW 4 101597807 missense probably benign 0.45
R6460:Dnajc6 UTSW 4 101615598 missense probably damaging 1.00
R6495:Dnajc6 UTSW 4 101635065 nonsense probably null
R6956:Dnajc6 UTSW 4 101614273 missense probably damaging 0.97
R7072:Dnajc6 UTSW 4 101615615 missense probably damaging 1.00
R7155:Dnajc6 UTSW 4 101612945 missense probably damaging 1.00
R7192:Dnajc6 UTSW 4 101597803 missense probably benign 0.02
R7226:Dnajc6 UTSW 4 101639372 missense probably damaging 1.00
R7298:Dnajc6 UTSW 4 101606611 missense probably benign 0.09
R7612:Dnajc6 UTSW 4 101597926 missense probably benign 0.40
R7652:Dnajc6 UTSW 4 101606677 missense probably damaging 0.98
R7789:Dnajc6 UTSW 4 101618532 missense possibly damaging 0.82
Z1088:Dnajc6 UTSW 4 101639329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTTTCTGTAGTGCGCAG -3'
(R):5'- CGTTCACATTCCTTATCATGAGAAG -3'

Sequencing Primer
(F):5'- CTGTAGTGCGCAGTAATTAATCTC -3'
(R):5'- TTCCTTATCATGAGAAGTGAATTCAC -3'
Posted On2019-10-24