Incidental Mutation 'R7622:Mycbp'
ID 589185
Institutional Source Beutler Lab
Gene Symbol Mycbp
Ensembl Gene ENSMUSG00000028647
Gene Name MYC binding protein
Synonyms 5730488M09Rik, Amy-1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.161) question?
Stock # R7622 (G1)
Quality Score 147.008
Status Validated
Chromosome 4
Chromosomal Location 123904832-123912269 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 123905301 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 28 (T28M)
Ref Sequence ENSEMBL: ENSMUSP00000101808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030400] [ENSMUST00000106202]
AlphaFold Q9EQS3
Predicted Effect probably damaging
Transcript: ENSMUST00000030400
AA Change: T28M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030400
Gene: ENSMUSG00000028647
AA Change: T28M

DomainStartEndE-ValueType
PDB:2YY0|D 42 94 2e-28 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000106202
AA Change: T28M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101808
Gene: ENSMUSG00000028647
AA Change: T28M

DomainStartEndE-ValueType
PDB:2YY0|D 42 82 4e-20 PDB
low complexity region 83 105 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the N-terminus of the oncogenic protein C-MYC, enhancing the ability of C-MYC to activate E box-dependent transcription. The encoded protein is normally found in the cytoplasm, but it translocates to the nucleus during S phase of the cell cycle and associates with C-MYC. This protein may be involved in spermatogenesis. This gene can be silenced by microRNA-22. Two transcript variants, one protein-coding and the other probably not protein-coding, have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,948,413 C1502* probably null Het
Adgrd1 G A 5: 129,139,624 D384N probably benign Het
Aqp8 T C 7: 123,466,660 F226S possibly damaging Het
Arl6ip6 A G 2: 53,217,327 Y207C probably damaging Het
Cbfa2t2 A G 2: 154,500,445 E27G possibly damaging Het
Cdc42bpb T G 12: 111,294,772 E201A unknown Het
Cfap54 A C 10: 92,956,944 V1769G unknown Het
Dmxl2 C T 9: 54,472,218 G7S probably damaging Het
Dnah6 G T 6: 73,124,759 F1927L possibly damaging Het
Dnajc6 A G 4: 101,640,491 E942G probably damaging Het
Fam170a A G 18: 50,282,902 R324G probably benign Het
Gapdhs G A 7: 30,739,331 T9I unknown Het
Gm10320 T A 13: 98,489,724 R51* probably null Het
Gm19410 A T 8: 35,810,347 T1776S possibly damaging Het
Gm4846 A T 1: 166,495,872 M94K possibly damaging Het
Ighv2-5 G A 12: 113,685,738 Q32* probably null Het
Klc2 T C 19: 5,111,632 E310G probably damaging Het
Krt75 A G 15: 101,570,272 M309T probably damaging Het
Lrp11 G A 10: 7,590,172 G41R unknown Het
Lrrc52 G T 1: 167,466,095 P207Q probably benign Het
Lrrc52 G T 1: 167,466,096 P207T probably benign Het
Lrrk2 A T 15: 91,812,323 D2438V probably damaging Het
Myh14 A G 7: 44,632,422 V804A probably benign Het
Myo16 A G 8: 10,376,238 I332V unknown Het
Ncor1 G T 11: 62,317,968 Q1359K probably benign Het
Olfr1055 A G 2: 86,347,662 Y35H possibly damaging Het
Olfr1112 A T 2: 87,192,250 I188L probably benign Het
Olfr50 A G 2: 36,793,931 K232E probably benign Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Oog3 T C 4: 144,158,319 D349G probably benign Het
Pate4 A G 9: 35,608,299 S32P possibly damaging Het
Pcdhb7 A C 18: 37,342,461 S217R probably benign Het
Pde1c G A 6: 56,126,925 R580C probably damaging Het
Pi4ka C A 16: 17,293,977 A1545S Het
Pign G T 1: 105,648,117 T266K possibly damaging Het
Pitpnm2 A G 5: 124,122,027 I1134T probably benign Het
Ppfia2 G A 10: 106,830,659 V409I possibly damaging Het
Prr7 A G 13: 55,472,796 T206A probably benign Het
Rnf13 A T 3: 57,820,534 R212* probably null Het
Rwdd2b T C 16: 87,434,612 N218S probably benign Het
Serpina3m A G 12: 104,389,575 D167G possibly damaging Het
Slit2 A T 5: 47,985,205 N56Y probably damaging Het
Sprr3 G T 3: 92,457,285 T84K probably damaging Het
Stab2 A T 10: 86,873,902 H1626Q possibly damaging Het
Tex2 C A 11: 106,546,895 D650Y unknown Het
Tmprss6 A G 15: 78,446,726 S436P probably benign Het
Uba2 A C 7: 34,165,435 F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 S242L probably damaging Het
Vmn1r86 T G 7: 13,102,758 I64L probably benign Het
Vmn2r67 A T 7: 85,136,454 V781E probably damaging Het
Vmn2r80 T A 10: 79,194,263 F641Y probably damaging Het
Wdfy4 A T 14: 33,078,274 I1965K Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Wdr90 G T 17: 25,854,109 F837L probably benign Het
Xpo4 A G 14: 57,597,011 V704A possibly damaging Het
Zc3h12d A G 10: 7,867,269 K268E probably damaging Het
Other mutations in Mycbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5980:Mycbp UTSW 4 123911096 missense probably benign 0.01
R7556:Mycbp UTSW 4 123905267 missense probably damaging 1.00
R8805:Mycbp UTSW 4 123910087 missense unknown
R9482:Mycbp UTSW 4 123910087 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCCCATTACAAAGTGAGGG -3'
(R):5'- GCTGCAAGAGTTTCAGTCCG -3'

Sequencing Primer
(F):5'- CATTACAAAGTGAGGGGGGCGCGGCG -3'
(R):5'- TTTCAGTCCGGGGCAGAGAG -3'
Posted On 2019-10-24