Incidental Mutation 'R7622:Adgrd1'
ID 589189
Institutional Source Beutler Lab
Gene Symbol Adgrd1
Ensembl Gene ENSMUSG00000044017
Gene Name adhesion G protein-coupled receptor D1
Synonyms Gpr133, E230012M21Rik
MMRRC Submission 045717-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7622 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 129173814-129281663 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 129216688 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 384 (D384N)
Ref Sequence ENSEMBL: ENSMUSP00000060307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]
AlphaFold Q80T32
Predicted Effect probably benign
Transcript: ENSMUST00000056617
AA Change: D384N

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017
AA Change: D384N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Laminin_G_3 119 273 2.9e-18 PFAM
Pfam:Pentaxin 171 288 2.2e-7 PFAM
GPS 535 585 1.57e-14 SMART
Pfam:Dicty_CAR 590 856 1.2e-8 PFAM
Pfam:7tm_2 592 831 8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156437
AA Change: D352N

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017
AA Change: D352N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Meta Mutation Damage Score 0.2306 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp8 T C 7: 123,065,883 (GRCm39) F226S possibly damaging Het
Arl6ip6 A G 2: 53,107,339 (GRCm39) Y207C probably damaging Het
Bltp1 C A 3: 37,002,562 (GRCm39) C1502* probably null Het
Cbfa2t2 A G 2: 154,342,365 (GRCm39) E27G possibly damaging Het
Cdc42bpb T G 12: 111,261,206 (GRCm39) E201A unknown Het
Cfap54 A C 10: 92,792,806 (GRCm39) V1769G unknown Het
Dmxl2 C T 9: 54,379,502 (GRCm39) G7S probably damaging Het
Dnah6 G T 6: 73,101,742 (GRCm39) F1927L possibly damaging Het
Dnajc6 A G 4: 101,497,688 (GRCm39) E942G probably damaging Het
Fam170a A G 18: 50,415,969 (GRCm39) R324G probably benign Het
Gapdhs G A 7: 30,438,756 (GRCm39) T9I unknown Het
Gm10320 T A 13: 98,626,232 (GRCm39) R51* probably null Het
Gm19410 A T 8: 36,277,501 (GRCm39) T1776S possibly damaging Het
Gm4846 A T 1: 166,323,441 (GRCm39) M94K possibly damaging Het
Ighv2-5 G A 12: 113,649,358 (GRCm39) Q32* probably null Het
Klc2 T C 19: 5,161,660 (GRCm39) E310G probably damaging Het
Krt75 A G 15: 101,478,707 (GRCm39) M309T probably damaging Het
Lrp11 G A 10: 7,465,936 (GRCm39) G41R unknown Het
Lrrc52 G T 1: 167,293,664 (GRCm39) P207Q probably benign Het
Lrrc52 G T 1: 167,293,665 (GRCm39) P207T probably benign Het
Lrrk2 A T 15: 91,696,526 (GRCm39) D2438V probably damaging Het
Mycbp C T 4: 123,799,094 (GRCm39) T28M probably damaging Het
Myh14 A G 7: 44,281,846 (GRCm39) V804A probably benign Het
Myo16 A G 8: 10,426,238 (GRCm39) I332V unknown Het
Ncor1 G T 11: 62,208,794 (GRCm39) Q1359K probably benign Het
Oog3 T C 4: 143,884,889 (GRCm39) D349G probably benign Het
Or12e1 A T 2: 87,022,594 (GRCm39) I188L probably benign Het
Or1j21 A G 2: 36,683,943 (GRCm39) K232E probably benign Het
Or52b4i A G 7: 102,191,830 (GRCm39) H229R probably benign Het
Or8k53 A G 2: 86,178,006 (GRCm39) Y35H possibly damaging Het
Pate4 A G 9: 35,519,595 (GRCm39) S32P possibly damaging Het
Pcdhb7 A C 18: 37,475,514 (GRCm39) S217R probably benign Het
Pde1c G A 6: 56,103,910 (GRCm39) R580C probably damaging Het
Pi4ka C A 16: 17,111,841 (GRCm39) A1545S Het
Pign G T 1: 105,575,842 (GRCm39) T266K possibly damaging Het
Pitpnm2 A G 5: 124,260,090 (GRCm39) I1134T probably benign Het
Ppfia2 G A 10: 106,666,520 (GRCm39) V409I possibly damaging Het
Prr7 A G 13: 55,620,609 (GRCm39) T206A probably benign Het
Rnf13 A T 3: 57,727,955 (GRCm39) R212* probably null Het
Rwdd2b T C 16: 87,231,500 (GRCm39) N218S probably benign Het
Serpina3m A G 12: 104,355,834 (GRCm39) D167G possibly damaging Het
Slit2 A T 5: 48,142,547 (GRCm39) N56Y probably damaging Het
Sprr3 G T 3: 92,364,592 (GRCm39) T84K probably damaging Het
Stab2 A T 10: 86,709,766 (GRCm39) H1626Q possibly damaging Het
Tex2 C A 11: 106,437,721 (GRCm39) D650Y unknown Het
Tmprss6 A G 15: 78,330,926 (GRCm39) S436P probably benign Het
Uba2 A C 7: 33,864,860 (GRCm39) F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 (GRCm39) S242L probably damaging Het
Vmn1r86 T G 7: 12,836,685 (GRCm39) I64L probably benign Het
Vmn2r67 A T 7: 84,785,662 (GRCm39) V781E probably damaging Het
Vmn2r80 T A 10: 79,030,097 (GRCm39) F641Y probably damaging Het
Wdfy4 A T 14: 32,800,231 (GRCm39) I1965K Het
Wdr25 G A 12: 108,958,819 (GRCm39) G344S possibly damaging Het
Wdr90 G T 17: 26,073,083 (GRCm39) F837L probably benign Het
Xpo4 A G 14: 57,834,468 (GRCm39) V704A possibly damaging Het
Zc3h12d A G 10: 7,743,033 (GRCm39) K268E probably damaging Het
Other mutations in Adgrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Adgrd1 APN 5 129,216,656 (GRCm39) missense probably benign 0.06
IGL01384:Adgrd1 APN 5 129,174,273 (GRCm39) missense possibly damaging 0.47
IGL01636:Adgrd1 APN 5 129,219,516 (GRCm39) splice site probably benign
IGL01916:Adgrd1 APN 5 129,209,902 (GRCm39) missense probably benign 0.12
IGL01923:Adgrd1 APN 5 129,255,143 (GRCm39) missense possibly damaging 0.58
IGL02019:Adgrd1 APN 5 129,192,202 (GRCm39) missense probably benign 0.00
IGL02142:Adgrd1 APN 5 129,208,648 (GRCm39) missense probably benign
IGL02149:Adgrd1 APN 5 129,256,325 (GRCm39) missense probably damaging 1.00
IGL02190:Adgrd1 APN 5 129,217,788 (GRCm39) splice site probably benign
IGL02623:Adgrd1 APN 5 129,209,809 (GRCm39) missense probably damaging 0.99
IGL02696:Adgrd1 APN 5 129,217,918 (GRCm39) splice site probably benign
IGL02850:Adgrd1 APN 5 129,192,119 (GRCm39) missense probably damaging 1.00
IGL02976:Adgrd1 APN 5 129,208,661 (GRCm39) missense probably benign 0.00
IGL02988:Adgrd1 UTSW 5 129,221,074 (GRCm39) missense probably benign 0.00
PIT4458001:Adgrd1 UTSW 5 129,208,641 (GRCm39) missense probably damaging 1.00
R0081:Adgrd1 UTSW 5 129,255,146 (GRCm39) missense probably damaging 0.99
R0266:Adgrd1 UTSW 5 129,216,658 (GRCm39) missense probably benign 0.00
R0267:Adgrd1 UTSW 5 129,216,658 (GRCm39) missense probably benign 0.00
R0464:Adgrd1 UTSW 5 129,239,714 (GRCm39) missense probably damaging 1.00
R0625:Adgrd1 UTSW 5 129,248,995 (GRCm39) critical splice donor site probably null
R1288:Adgrd1 UTSW 5 129,206,071 (GRCm39) missense probably damaging 0.97
R1460:Adgrd1 UTSW 5 129,199,627 (GRCm39) missense possibly damaging 0.63
R1635:Adgrd1 UTSW 5 129,205,971 (GRCm39) missense probably damaging 1.00
R1658:Adgrd1 UTSW 5 129,255,164 (GRCm39) missense probably benign 0.02
R1709:Adgrd1 UTSW 5 129,256,292 (GRCm39) missense possibly damaging 0.95
R1897:Adgrd1 UTSW 5 129,206,065 (GRCm39) missense probably benign 0.01
R1976:Adgrd1 UTSW 5 129,217,861 (GRCm39) missense probably benign 0.06
R2049:Adgrd1 UTSW 5 129,192,159 (GRCm39) missense probably benign 0.01
R2259:Adgrd1 UTSW 5 129,189,375 (GRCm39) missense possibly damaging 0.92
R2295:Adgrd1 UTSW 5 129,199,570 (GRCm39) missense probably benign 0.13
R3076:Adgrd1 UTSW 5 129,206,169 (GRCm39) missense probably benign 0.20
R3077:Adgrd1 UTSW 5 129,206,169 (GRCm39) missense probably benign 0.20
R3078:Adgrd1 UTSW 5 129,206,169 (GRCm39) missense probably benign 0.20
R4581:Adgrd1 UTSW 5 129,279,595 (GRCm39) missense possibly damaging 0.68
R5024:Adgrd1 UTSW 5 129,248,959 (GRCm39) missense probably damaging 1.00
R5076:Adgrd1 UTSW 5 129,221,053 (GRCm39) nonsense probably null
R5227:Adgrd1 UTSW 5 129,199,647 (GRCm39) missense probably benign 0.00
R5453:Adgrd1 UTSW 5 129,256,647 (GRCm39) missense probably damaging 0.99
R6349:Adgrd1 UTSW 5 129,219,603 (GRCm39) splice site probably null
R6953:Adgrd1 UTSW 5 129,192,142 (GRCm39) nonsense probably null
R7300:Adgrd1 UTSW 5 129,174,411 (GRCm39) critical splice donor site probably null
R7583:Adgrd1 UTSW 5 129,256,652 (GRCm39) missense probably benign 0.42
R8205:Adgrd1 UTSW 5 129,192,175 (GRCm39) missense possibly damaging 0.94
R8716:Adgrd1 UTSW 5 129,265,435 (GRCm39) missense possibly damaging 0.94
R8780:Adgrd1 UTSW 5 129,174,138 (GRCm39) start gained probably benign
R8850:Adgrd1 UTSW 5 129,219,574 (GRCm39) missense probably benign 0.00
R9528:Adgrd1 UTSW 5 129,256,740 (GRCm39) missense probably benign 0.44
R9569:Adgrd1 UTSW 5 129,256,701 (GRCm39) missense possibly damaging 0.90
R9626:Adgrd1 UTSW 5 129,275,721 (GRCm39) missense probably damaging 1.00
X0067:Adgrd1 UTSW 5 129,265,416 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCCAAGAACTCATCGGGTCAG -3'
(R):5'- TCTCAGCTGCTGTGTAAAGAC -3'

Sequencing Primer
(F):5'- AGAACTCATCGGGTCAGGTCAC -3'
(R):5'- CTGCTGTGTAAAGACCAATGACCTG -3'
Posted On 2019-10-24