Mutagenetix > Incidental Mutation

Incidental Mutation 'R7622:Pde1c'

589190

Institutional Source

Beutler Lab

Gene Symbol

Pde1c

Ensembl Gene

ENSMUSG00000004347

Gene Name

phosphodiesterase 1C

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R7622 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56069804-56569103 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 56126925 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 580 (R580C)

Ref Sequence

ENSEMBL: ENSMUSP00000046601 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044505] [ENSMUST00000114327] [ENSMUST00000164037] [ENSMUST00000164752] [ENSMUST00000166102] [ENSMUST00000166890] [ENSMUST00000168944] [ENSMUST00000170774] [ENSMUST00000203372]

AlphaFold

Q64338

Predicted Effect

probably damaging
Transcript: ENSMUST00000044505
AA Change: R580C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000046601
Gene: ENSMUSG00000004347
AA Change: R580C

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	82	142	3.8e-34	PFAM
HDc	225	390	1.02e-5	SMART
Blast:HDc	402	681	1e-123	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000114327
AA Change: R580C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000109966
Gene: ENSMUSG00000004347
AA Change: R580C

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	82	142	4.7e-31	PFAM
HDc	225	390	1.02e-5	SMART
Blast:HDc	402	650	1e-110	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164037
AA Change: R571C

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000130139
Gene: ENSMUSG00000004347
AA Change: R571C

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	73	133	8e-32	PFAM
HDc	216	381	1.02e-5	SMART
Blast:HDc	393	618	1e-102	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000164752
AA Change: R580C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000129185
Gene: ENSMUSG00000004347
AA Change: R580C

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	82	142	3e-28	PFAM
HDc	225	390	5.7e-8	SMART
Blast:HDc	402	627	1e-101	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000166102
AA Change: R580C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131350
Gene: ENSMUSG00000004347
AA Change: R580C

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	82	142	3e-28	PFAM
HDc	225	390	5.7e-8	SMART
Blast:HDc	402	627	1e-101	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000166890
AA Change: R552C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131892
Gene: ENSMUSG00000004347
AA Change: R552C

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	54	114	3.5e-31	PFAM
HDc	197	362	1.02e-5	SMART
Blast:HDc	374	599	1e-102	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000168944
AA Change: R580C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000128364
Gene: ENSMUSG00000004347
AA Change: R580C

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	82	142	4.7e-31	PFAM
HDc	225	390	1.02e-5	SMART
Blast:HDc	402	650	1e-110	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000170774
AA Change: R543C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133170
Gene: ENSMUSG00000004347
AA Change: R543C

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	45	105	3.6e-31	PFAM
HDc	188	353	1.02e-5	SMART
Blast:HDc	365	613	1e-110	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000203372
AA Change: R640C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000145508
Gene: ENSMUSG00000004347
AA Change: R640C

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	142	202	3.1e-31	PFAM
HDc	285	450	5.8e-8	SMART
Blast:HDc	462	741	1e-122	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000203462

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the 3'5'-cyclic nucleotide phosphodiesterase family. Members of this family catalyze hydrolysis of the cyclic nucleotides, cyclic adenosine monophosphate and cyclic guanosine monophosphate, to the corresponding nucleoside 5'-monophosphates. The enzyme encoded by this gene regulates proliferation and migration of vascular smooth muscle cells, and neointimal hyperplasia. This enzyme also plays a role in pathological vascular remodeling by regulating the stability of growth factor receptors, such as PDGF-receptor-beta. [provided by RefSeq, Jul 2016]
PHENOTYPE: Olfactory sensory nerves from homozygous null mice have significantly reduced action potentials in response to odor with slower onset kinetics and a faster response termination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,948,413	C1502*	probably null	Het
Adgrd1	G	A	5: 129,139,624	D384N	probably benign	Het
Aqp8	T	C	7: 123,466,660	F226S	possibly damaging	Het
Arl6ip6	A	G	2: 53,217,327	Y207C	probably damaging	Het
Cbfa2t2	A	G	2: 154,500,445	E27G	possibly damaging	Het
Cdc42bpb	T	G	12: 111,294,772	E201A	unknown	Het
Cfap54	A	C	10: 92,956,944	V1769G	unknown	Het
Dmxl2	C	T	9: 54,472,218	G7S	probably damaging	Het
Dnah6	G	T	6: 73,124,759	F1927L	possibly damaging	Het
Dnajc6	A	G	4: 101,640,491	E942G	probably damaging	Het
Fam170a	A	G	18: 50,282,902	R324G	probably benign	Het
Gapdhs	G	A	7: 30,739,331	T9I	unknown	Het
Gm10320	T	A	13: 98,489,724	R51*	probably null	Het
Gm19410	A	T	8: 35,810,347	T1776S	possibly damaging	Het
Gm4846	A	T	1: 166,495,872	M94K	possibly damaging	Het
Ighv2-5	G	A	12: 113,685,738	Q32*	probably null	Het
Klc2	T	C	19: 5,111,632	E310G	probably damaging	Het
Krt75	A	G	15: 101,570,272	M309T	probably damaging	Het
Lrp11	G	A	10: 7,590,172	G41R	unknown	Het
Lrrc52	G	T	1: 167,466,095	P207Q	probably benign	Het
Lrrc52	G	T	1: 167,466,096	P207T	probably benign	Het
Lrrk2	A	T	15: 91,812,323	D2438V	probably damaging	Het
Mycbp	C	T	4: 123,905,301	T28M	probably damaging	Het
Myh14	A	G	7: 44,632,422	V804A	probably benign	Het
Myo16	A	G	8: 10,376,238	I332V	unknown	Het
Ncor1	G	T	11: 62,317,968	Q1359K	probably benign	Het
Olfr1055	A	G	2: 86,347,662	Y35H	possibly damaging	Het
Olfr1112	A	T	2: 87,192,250	I188L	probably benign	Het
Olfr50	A	G	2: 36,793,931	K232E	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,623	H229R	probably benign	Het
Oog3	T	C	4: 144,158,319	D349G	probably benign	Het
Pate4	A	G	9: 35,608,299	S32P	possibly damaging	Het
Pcdhb7	A	C	18: 37,342,461	S217R	probably benign	Het
Pi4ka	C	A	16: 17,293,977	A1545S		Het
Pign	G	T	1: 105,648,117	T266K	possibly damaging	Het
Pitpnm2	A	G	5: 124,122,027	I1134T	probably benign	Het
Ppfia2	G	A	10: 106,830,659	V409I	possibly damaging	Het
Prr7	A	G	13: 55,472,796	T206A	probably benign	Het
Rnf13	A	T	3: 57,820,534	R212*	probably null	Het
Rwdd2b	T	C	16: 87,434,612	N218S	probably benign	Het
Serpina3m	A	G	12: 104,389,575	D167G	possibly damaging	Het
Slit2	A	T	5: 47,985,205	N56Y	probably damaging	Het
Sprr3	G	T	3: 92,457,285	T84K	probably damaging	Het
Stab2	A	T	10: 86,873,902	H1626Q	possibly damaging	Het
Tex2	C	A	11: 106,546,895	D650Y	unknown	Het
Tmprss6	A	G	15: 78,446,726	S436P	probably benign	Het
Uba2	A	C	7: 34,165,435	F63L	probably damaging	Het
Ubxn2b	C	T	4: 6,214,692	S242L	probably damaging	Het
Vmn1r86	T	G	7: 13,102,758	I64L	probably benign	Het
Vmn2r67	A	T	7: 85,136,454	V781E	probably damaging	Het
Vmn2r80	T	A	10: 79,194,263	F641Y	probably damaging	Het
Wdfy4	A	T	14: 33,078,274	I1965K		Het
Wdr25	G	A	12: 108,992,893	G344S	possibly damaging	Het
Wdr90	G	T	17: 25,854,109	F837L	probably benign	Het
Xpo4	A	G	14: 57,597,011	V704A	possibly damaging	Het
Zc3h12d	A	G	10: 7,867,269	K268E	probably damaging	Het

Other mutations in Pde1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00886:Pde1c	APN	6	56173674	missense	probably damaging	1.00
IGL02316:Pde1c	APN	6	56151351	missense	possibly damaging	0.77
IGL02751:Pde1c	APN	6	56181688	missense	probably damaging	1.00
IGL02801:Pde1c	APN	6	56173666	missense	probably damaging	1.00
IGL02975:Pde1c	APN	6	56158936	missense	probably damaging	1.00
IGL03357:Pde1c	APN	6	56180093	missense	probably damaging	1.00
R0523:Pde1c	UTSW	6	56174941	missense	probably damaging	1.00
R0717:Pde1c	UTSW	6	56123012	missense	probably damaging	0.98
R0973:Pde1c	UTSW	6	56361815	missense	probably benign	0.00
R1344:Pde1c	UTSW	6	56361767	missense	probably benign	0.08
R1521:Pde1c	UTSW	6	56173607	missense	possibly damaging	0.91
R1818:Pde1c	UTSW	6	56126892	nonsense	probably null
R2004:Pde1c	UTSW	6	56159011	missense	probably damaging	1.00
R2026:Pde1c	UTSW	6	56180190	missense	probably damaging	1.00
R4380:Pde1c	UTSW	6	56072278	missense	probably null	0.02
R4729:Pde1c	UTSW	6	56072209	missense	probably damaging	1.00
R4847:Pde1c	UTSW	6	56123034	missense	possibly damaging	0.52
R4993:Pde1c	UTSW	6	56150624	missense	probably damaging	0.98
R5666:Pde1c	UTSW	6	56126857	critical splice donor site	probably null
R6005:Pde1c	UTSW	6	56479202	splice site	probably null
R6636:Pde1c	UTSW	6	56180102	missense	probably damaging	1.00
R6701:Pde1c	UTSW	6	56181700	missense	probably damaging	1.00
R6990:Pde1c	UTSW	6	56442035	missense	possibly damaging	0.92
R7607:Pde1c	UTSW	6	56150628	missense	probably damaging	1.00
R8260:Pde1c	UTSW	6	56137419	missense	probably benign
R8416:Pde1c	UTSW	6	56151291	critical splice donor site	probably null
R8898:Pde1c	UTSW	6	56137386	missense	probably damaging	0.99
R8904:Pde1c	UTSW	6	56179143	missense	possibly damaging	0.47
R9280:Pde1c	UTSW	6	56137520	missense	probably benign	0.44
R9405:Pde1c	UTSW	6	56072214	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAAGGGAGCCATGTCAGCTG -3'
(R):5'- ACTGGTTCCCATGGACATTAG -3'

Sequencing Primer
(F):5'- CCATGTCAGCTGCCAGC -3'
(R):5'- ACTGGTTCCCATGGACATTAGTCTTG -3'

Posted On

2019-10-24