Incidental Mutation 'R7622:Dnah6'
ID 589191
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Name dynein, axonemal, heavy chain 6
Synonyms A730004I20Rik, Dnahc6
MMRRC Submission 045717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R7622 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 72994589-73198634 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 73101742 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1927 (F1927L)
Ref Sequence ENSEMBL: ENSMUSP00000068758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000064948
AA Change: F1927L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: F1927L

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114040
AA Change: F1875L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: F1875L

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204053
AA Change: F1927L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: F1927L

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 G A 5: 129,216,688 (GRCm39) D384N probably benign Het
Aqp8 T C 7: 123,065,883 (GRCm39) F226S possibly damaging Het
Arl6ip6 A G 2: 53,107,339 (GRCm39) Y207C probably damaging Het
Bltp1 C A 3: 37,002,562 (GRCm39) C1502* probably null Het
Cbfa2t2 A G 2: 154,342,365 (GRCm39) E27G possibly damaging Het
Cdc42bpb T G 12: 111,261,206 (GRCm39) E201A unknown Het
Cfap54 A C 10: 92,792,806 (GRCm39) V1769G unknown Het
Dmxl2 C T 9: 54,379,502 (GRCm39) G7S probably damaging Het
Dnajc6 A G 4: 101,497,688 (GRCm39) E942G probably damaging Het
Fam170a A G 18: 50,415,969 (GRCm39) R324G probably benign Het
Gapdhs G A 7: 30,438,756 (GRCm39) T9I unknown Het
Gm10320 T A 13: 98,626,232 (GRCm39) R51* probably null Het
Gm19410 A T 8: 36,277,501 (GRCm39) T1776S possibly damaging Het
Gm4846 A T 1: 166,323,441 (GRCm39) M94K possibly damaging Het
Ighv2-5 G A 12: 113,649,358 (GRCm39) Q32* probably null Het
Klc2 T C 19: 5,161,660 (GRCm39) E310G probably damaging Het
Krt75 A G 15: 101,478,707 (GRCm39) M309T probably damaging Het
Lrp11 G A 10: 7,465,936 (GRCm39) G41R unknown Het
Lrrc52 G T 1: 167,293,664 (GRCm39) P207Q probably benign Het
Lrrc52 G T 1: 167,293,665 (GRCm39) P207T probably benign Het
Lrrk2 A T 15: 91,696,526 (GRCm39) D2438V probably damaging Het
Mycbp C T 4: 123,799,094 (GRCm39) T28M probably damaging Het
Myh14 A G 7: 44,281,846 (GRCm39) V804A probably benign Het
Myo16 A G 8: 10,426,238 (GRCm39) I332V unknown Het
Ncor1 G T 11: 62,208,794 (GRCm39) Q1359K probably benign Het
Oog3 T C 4: 143,884,889 (GRCm39) D349G probably benign Het
Or12e1 A T 2: 87,022,594 (GRCm39) I188L probably benign Het
Or1j21 A G 2: 36,683,943 (GRCm39) K232E probably benign Het
Or52b4i A G 7: 102,191,830 (GRCm39) H229R probably benign Het
Or8k53 A G 2: 86,178,006 (GRCm39) Y35H possibly damaging Het
Pate4 A G 9: 35,519,595 (GRCm39) S32P possibly damaging Het
Pcdhb7 A C 18: 37,475,514 (GRCm39) S217R probably benign Het
Pde1c G A 6: 56,103,910 (GRCm39) R580C probably damaging Het
Pi4ka C A 16: 17,111,841 (GRCm39) A1545S Het
Pign G T 1: 105,575,842 (GRCm39) T266K possibly damaging Het
Pitpnm2 A G 5: 124,260,090 (GRCm39) I1134T probably benign Het
Ppfia2 G A 10: 106,666,520 (GRCm39) V409I possibly damaging Het
Prr7 A G 13: 55,620,609 (GRCm39) T206A probably benign Het
Rnf13 A T 3: 57,727,955 (GRCm39) R212* probably null Het
Rwdd2b T C 16: 87,231,500 (GRCm39) N218S probably benign Het
Serpina3m A G 12: 104,355,834 (GRCm39) D167G possibly damaging Het
Slit2 A T 5: 48,142,547 (GRCm39) N56Y probably damaging Het
Sprr3 G T 3: 92,364,592 (GRCm39) T84K probably damaging Het
Stab2 A T 10: 86,709,766 (GRCm39) H1626Q possibly damaging Het
Tex2 C A 11: 106,437,721 (GRCm39) D650Y unknown Het
Tmprss6 A G 15: 78,330,926 (GRCm39) S436P probably benign Het
Uba2 A C 7: 33,864,860 (GRCm39) F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 (GRCm39) S242L probably damaging Het
Vmn1r86 T G 7: 12,836,685 (GRCm39) I64L probably benign Het
Vmn2r67 A T 7: 84,785,662 (GRCm39) V781E probably damaging Het
Vmn2r80 T A 10: 79,030,097 (GRCm39) F641Y probably damaging Het
Wdfy4 A T 14: 32,800,231 (GRCm39) I1965K Het
Wdr25 G A 12: 108,958,819 (GRCm39) G344S possibly damaging Het
Wdr90 G T 17: 26,073,083 (GRCm39) F837L probably benign Het
Xpo4 A G 14: 57,834,468 (GRCm39) V704A possibly damaging Het
Zc3h12d A G 10: 7,743,033 (GRCm39) K268E probably damaging Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73,172,720 (GRCm39) missense probably benign 0.00
IGL00488:Dnah6 APN 6 73,063,190 (GRCm39) missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73,172,744 (GRCm39) missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73,189,417 (GRCm39) critical splice donor site probably null
IGL00756:Dnah6 APN 6 73,100,754 (GRCm39) missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73,133,333 (GRCm39) missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73,010,509 (GRCm39) splice site probably benign
IGL00972:Dnah6 APN 6 73,060,140 (GRCm39) splice site probably benign
IGL00975:Dnah6 APN 6 73,150,373 (GRCm39) missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73,051,764 (GRCm39) splice site probably benign
IGL01307:Dnah6 APN 6 73,042,708 (GRCm39) missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73,150,439 (GRCm39) missense probably benign 0.01
IGL01362:Dnah6 APN 6 73,069,161 (GRCm39) missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73,051,731 (GRCm39) missense probably benign 0.10
IGL01559:Dnah6 APN 6 73,001,235 (GRCm39) critical splice donor site probably null
IGL01622:Dnah6 APN 6 73,121,701 (GRCm39) missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73,121,701 (GRCm39) missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73,052,785 (GRCm39) missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73,053,643 (GRCm39) nonsense probably null
IGL01736:Dnah6 APN 6 73,165,360 (GRCm39) missense probably benign 0.06
IGL01825:Dnah6 APN 6 73,042,759 (GRCm39) missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73,112,784 (GRCm39) missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73,009,552 (GRCm39) missense probably benign 0.04
IGL01935:Dnah6 APN 6 73,037,126 (GRCm39) missense probably benign
IGL02126:Dnah6 APN 6 73,080,149 (GRCm39) missense probably benign 0.01
IGL02191:Dnah6 APN 6 72,994,780 (GRCm39) missense probably benign 0.00
IGL02293:Dnah6 APN 6 73,110,633 (GRCm39) splice site probably benign
IGL02316:Dnah6 APN 6 73,145,894 (GRCm39) missense probably benign 0.19
IGL02339:Dnah6 APN 6 73,078,881 (GRCm39) missense probably benign 0.00
IGL02380:Dnah6 APN 6 73,053,623 (GRCm39) missense probably benign 0.12
IGL02458:Dnah6 APN 6 73,004,431 (GRCm39) missense probably benign 0.43
IGL02499:Dnah6 APN 6 72,998,210 (GRCm39) missense probably benign 0.12
IGL02652:Dnah6 APN 6 73,072,087 (GRCm39) missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73,098,806 (GRCm39) missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73,185,582 (GRCm39) missense probably benign 0.03
IGL02875:Dnah6 APN 6 73,115,698 (GRCm39) missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73,009,570 (GRCm39) missense probably benign 0.01
IGL02989:Dnah6 APN 6 73,046,403 (GRCm39) missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73,126,123 (GRCm39) missense probably benign 0.19
IGL03135:Dnah6 APN 6 73,121,987 (GRCm39) missense probably benign 0.00
IGL03145:Dnah6 APN 6 73,018,037 (GRCm39) missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73,121,683 (GRCm39) missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73,030,630 (GRCm39) splice site probably benign
IGL03286:Dnah6 APN 6 73,060,068 (GRCm39) missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73,052,833 (GRCm39) missense probably benign 0.15
P0025:Dnah6 UTSW 6 73,140,487 (GRCm39) missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73,042,738 (GRCm39) missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73,185,624 (GRCm39) missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73,078,863 (GRCm39) missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73,091,565 (GRCm39) missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73,037,243 (GRCm39) missense probably benign 0.02
R0103:Dnah6 UTSW 6 73,069,155 (GRCm39) missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73,069,155 (GRCm39) missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73,132,262 (GRCm39) missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73,132,262 (GRCm39) missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73,015,717 (GRCm39) splice site probably benign
R0164:Dnah6 UTSW 6 73,165,518 (GRCm39) splice site probably benign
R0165:Dnah6 UTSW 6 72,998,306 (GRCm39) missense probably benign 0.01
R0183:Dnah6 UTSW 6 73,059,906 (GRCm39) missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73,046,403 (GRCm39) missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73,136,098 (GRCm39) missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73,150,541 (GRCm39) missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73,046,382 (GRCm39) splice site probably benign
R0345:Dnah6 UTSW 6 72,998,240 (GRCm39) missense probably benign 0.12
R0357:Dnah6 UTSW 6 73,165,342 (GRCm39) missense probably benign
R0362:Dnah6 UTSW 6 73,185,592 (GRCm39) missense probably benign 0.06
R0377:Dnah6 UTSW 6 73,098,975 (GRCm39) missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73,060,107 (GRCm39) missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73,021,757 (GRCm39) missense probably benign 0.15
R0639:Dnah6 UTSW 6 72,999,395 (GRCm39) missense probably benign 0.02
R0673:Dnah6 UTSW 6 73,100,794 (GRCm39) missense probably benign 0.01
R0690:Dnah6 UTSW 6 73,106,457 (GRCm39) missense probably benign 0.01
R0708:Dnah6 UTSW 6 73,189,605 (GRCm39) missense probably benign 0.05
R0711:Dnah6 UTSW 6 73,064,585 (GRCm39) missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73,012,276 (GRCm39) missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73,101,740 (GRCm39) missense probably benign 0.00
R0972:Dnah6 UTSW 6 73,136,176 (GRCm39) missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73,121,948 (GRCm39) missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73,136,118 (GRCm39) missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73,101,692 (GRCm39) missense probably benign 0.22
R1301:Dnah6 UTSW 6 73,185,528 (GRCm39) critical splice donor site probably null
R1341:Dnah6 UTSW 6 73,168,602 (GRCm39) missense probably benign 0.09
R1509:Dnah6 UTSW 6 73,004,425 (GRCm39) missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73,026,031 (GRCm39) missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73,128,536 (GRCm39) missense probably benign
R1557:Dnah6 UTSW 6 73,026,114 (GRCm39) nonsense probably null
R1591:Dnah6 UTSW 6 73,053,583 (GRCm39) missense probably benign 0.01
R1602:Dnah6 UTSW 6 73,044,452 (GRCm39) missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73,121,946 (GRCm39) missense probably benign 0.09
R1616:Dnah6 UTSW 6 73,077,095 (GRCm39) missense probably benign 0.10
R1643:Dnah6 UTSW 6 73,021,735 (GRCm39) missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73,132,279 (GRCm39) missense probably benign 0.18
R1655:Dnah6 UTSW 6 73,182,715 (GRCm39) missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73,101,761 (GRCm39) missense probably benign 0.00
R1665:Dnah6 UTSW 6 73,101,761 (GRCm39) missense probably benign 0.00
R1675:Dnah6 UTSW 6 73,106,523 (GRCm39) missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73,021,744 (GRCm39) missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73,137,965 (GRCm39) missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73,001,941 (GRCm39) missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73,158,780 (GRCm39) missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73,077,071 (GRCm39) missense probably benign 0.00
R1897:Dnah6 UTSW 6 73,158,745 (GRCm39) missense probably benign 0.30
R1951:Dnah6 UTSW 6 73,061,704 (GRCm39) nonsense probably null
R1978:Dnah6 UTSW 6 73,098,953 (GRCm39) missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73,072,027 (GRCm39) missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73,069,175 (GRCm39) missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73,044,449 (GRCm39) missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73,150,402 (GRCm39) missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73,004,405 (GRCm39) missense probably benign
R2041:Dnah6 UTSW 6 73,050,422 (GRCm39) missense probably damaging 1.00
R2068:Dnah6 UTSW 6 72,998,165 (GRCm39) missense probably benign 0.23
R2114:Dnah6 UTSW 6 73,121,018 (GRCm39) missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73,026,149 (GRCm39) missense probably benign 0.32
R2163:Dnah6 UTSW 6 73,066,729 (GRCm39) splice site probably null
R2193:Dnah6 UTSW 6 73,115,623 (GRCm39) missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73,077,068 (GRCm39) missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73,090,564 (GRCm39) missense probably benign 0.15
R2292:Dnah6 UTSW 6 72,998,092 (GRCm39) missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73,133,404 (GRCm39) missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73,068,950 (GRCm39) splice site probably null
R2436:Dnah6 UTSW 6 73,126,156 (GRCm39) missense probably benign 0.05
R2847:Dnah6 UTSW 6 73,106,314 (GRCm39) missense probably benign 0.41
R2848:Dnah6 UTSW 6 73,106,314 (GRCm39) missense probably benign 0.41
R3033:Dnah6 UTSW 6 73,150,333 (GRCm39) missense probably benign 0.03
R3429:Dnah6 UTSW 6 73,098,797 (GRCm39) missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73,098,797 (GRCm39) missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73,009,616 (GRCm39) missense probably benign 0.21
R3811:Dnah6 UTSW 6 73,168,481 (GRCm39) missense probably benign 0.00
R3852:Dnah6 UTSW 6 73,104,910 (GRCm39) missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73,098,975 (GRCm39) missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73,066,575 (GRCm39) nonsense probably null
R4246:Dnah6 UTSW 6 73,106,431 (GRCm39) missense probably benign 0.00
R4367:Dnah6 UTSW 6 73,126,467 (GRCm39) missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73,095,009 (GRCm39) missense probably benign 0.01
R4405:Dnah6 UTSW 6 73,106,274 (GRCm39) missense probably benign 0.00
R4420:Dnah6 UTSW 6 73,168,462 (GRCm39) missense probably benign
R4486:Dnah6 UTSW 6 73,015,729 (GRCm39) missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73,155,399 (GRCm39) missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73,169,388 (GRCm39) missense probably benign
R4573:Dnah6 UTSW 6 73,063,164 (GRCm39) missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73,063,164 (GRCm39) missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73,129,695 (GRCm39) missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73,106,643 (GRCm39) missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73,047,580 (GRCm39) missense probably benign
R4653:Dnah6 UTSW 6 73,050,440 (GRCm39) missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73,014,671 (GRCm39) missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73,169,405 (GRCm39) missense probably benign 0.04
R4712:Dnah6 UTSW 6 73,001,995 (GRCm39) critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73,106,513 (GRCm39) missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73,072,057 (GRCm39) missense probably benign 0.11
R4792:Dnah6 UTSW 6 73,066,651 (GRCm39) missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73,066,681 (GRCm39) missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73,066,681 (GRCm39) missense probably damaging 1.00
R4817:Dnah6 UTSW 6 72,999,407 (GRCm39) missense probably benign 0.02
R4830:Dnah6 UTSW 6 73,021,745 (GRCm39) missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73,098,771 (GRCm39) missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73,169,659 (GRCm39) intron probably benign
R4948:Dnah6 UTSW 6 73,030,672 (GRCm39) missense probably benign 0.00
R4953:Dnah6 UTSW 6 73,165,366 (GRCm39) missense probably benign 0.19
R5000:Dnah6 UTSW 6 73,121,798 (GRCm39) missense probably benign 0.26
R5036:Dnah6 UTSW 6 73,021,674 (GRCm39) missense probably benign
R5044:Dnah6 UTSW 6 73,014,605 (GRCm39) missense probably benign 0.41
R5143:Dnah6 UTSW 6 73,158,744 (GRCm39) missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73,172,617 (GRCm39) missense probably benign
R5186:Dnah6 UTSW 6 73,044,410 (GRCm39) missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73,172,715 (GRCm39) missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73,090,471 (GRCm39) missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73,104,844 (GRCm39) critical splice donor site probably null
R5330:Dnah6 UTSW 6 73,051,573 (GRCm39) missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73,051,573 (GRCm39) missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73,189,603 (GRCm39) missense probably benign
R5343:Dnah6 UTSW 6 73,189,599 (GRCm39) missense probably benign
R5375:Dnah6 UTSW 6 73,100,838 (GRCm39) missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73,014,598 (GRCm39) missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73,037,121 (GRCm39) missense probably benign 0.00
R5455:Dnah6 UTSW 6 73,052,717 (GRCm39) missense probably benign 0.00
R5458:Dnah6 UTSW 6 73,063,168 (GRCm39) missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73,069,140 (GRCm39) missense probably benign 0.04
R5484:Dnah6 UTSW 6 73,069,099 (GRCm39) missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73,167,402 (GRCm39) missense probably null 0.00
R5527:Dnah6 UTSW 6 73,136,212 (GRCm39) missense probably benign
R5541:Dnah6 UTSW 6 73,169,971 (GRCm39) missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73,128,672 (GRCm39) missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73,126,508 (GRCm39) missense probably damaging 1.00
R5689:Dnah6 UTSW 6 72,998,210 (GRCm39) missense probably benign 0.12
R5966:Dnah6 UTSW 6 73,037,262 (GRCm39) missense probably benign 0.00
R5980:Dnah6 UTSW 6 73,158,705 (GRCm39) missense probably benign 0.01
R6049:Dnah6 UTSW 6 73,063,149 (GRCm39) missense probably benign 0.38
R6092:Dnah6 UTSW 6 73,091,680 (GRCm39) missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73,165,477 (GRCm39) missense probably benign 0.16
R6279:Dnah6 UTSW 6 73,042,798 (GRCm39) missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73,042,798 (GRCm39) missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73,063,200 (GRCm39) missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73,168,588 (GRCm39) missense probably benign 0.02
R6394:Dnah6 UTSW 6 73,132,401 (GRCm39) nonsense probably null
R6470:Dnah6 UTSW 6 73,051,569 (GRCm39) missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73,051,687 (GRCm39) missense probably benign 0.05
R6545:Dnah6 UTSW 6 73,021,715 (GRCm39) missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73,150,516 (GRCm39) missense probably benign 0.02
R6609:Dnah6 UTSW 6 73,030,678 (GRCm39) missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73,012,263 (GRCm39) splice site probably null
R6640:Dnah6 UTSW 6 73,001,276 (GRCm39) missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73,115,743 (GRCm39) missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73,014,532 (GRCm39) missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73,110,591 (GRCm39) missense probably benign 0.29
R6845:Dnah6 UTSW 6 73,110,525 (GRCm39) missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73,189,505 (GRCm39) missense probably benign 0.00
R6918:Dnah6 UTSW 6 73,158,738 (GRCm39) nonsense probably null
R6929:Dnah6 UTSW 6 73,021,756 (GRCm39) missense probably damaging 0.96
R6981:Dnah6 UTSW 6 72,998,161 (GRCm39) missense probably benign 0.00
R7065:Dnah6 UTSW 6 73,064,545 (GRCm39) missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73,112,663 (GRCm39) missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73,015,729 (GRCm39) missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73,158,688 (GRCm39) critical splice donor site probably null
R7203:Dnah6 UTSW 6 73,150,528 (GRCm39) missense probably benign 0.00
R7315:Dnah6 UTSW 6 73,061,743 (GRCm39) missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73,121,705 (GRCm39) nonsense probably null
R7387:Dnah6 UTSW 6 73,189,595 (GRCm39) nonsense probably null
R7388:Dnah6 UTSW 6 73,169,300 (GRCm39) missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73,189,475 (GRCm39) missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73,104,887 (GRCm39) missense probably benign 0.04
R7524:Dnah6 UTSW 6 73,095,082 (GRCm39) missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73,004,423 (GRCm39) missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73,126,413 (GRCm39) missense probably benign 0.01
R7604:Dnah6 UTSW 6 73,069,151 (GRCm39) missense probably damaging 1.00
R7615:Dnah6 UTSW 6 73,072,189 (GRCm39) missense possibly damaging 0.85
R7690:Dnah6 UTSW 6 73,146,063 (GRCm39) splice site probably null
R7735:Dnah6 UTSW 6 73,046,412 (GRCm39) missense probably damaging 1.00
R7754:Dnah6 UTSW 6 73,002,703 (GRCm39) missense probably benign 0.41
R7829:Dnah6 UTSW 6 73,104,902 (GRCm39) nonsense probably null
R7904:Dnah6 UTSW 6 73,112,450 (GRCm39) splice site probably null
R8034:Dnah6 UTSW 6 73,106,208 (GRCm39) missense probably damaging 1.00
R8093:Dnah6 UTSW 6 73,137,896 (GRCm39) missense probably damaging 1.00
R8120:Dnah6 UTSW 6 73,002,769 (GRCm39) missense probably damaging 1.00
R8178:Dnah6 UTSW 6 73,037,208 (GRCm39) missense probably benign 0.16
R8206:Dnah6 UTSW 6 73,014,549 (GRCm39) nonsense probably null
R8214:Dnah6 UTSW 6 73,021,711 (GRCm39) missense probably damaging 1.00
R8269:Dnah6 UTSW 6 73,145,810 (GRCm39) critical splice donor site probably null
R8273:Dnah6 UTSW 6 73,172,664 (GRCm39) missense probably benign 0.00
R8273:Dnah6 UTSW 6 73,053,582 (GRCm39) missense probably benign 0.31
R8331:Dnah6 UTSW 6 73,001,983 (GRCm39) missense probably benign 0.10
R8350:Dnah6 UTSW 6 73,172,798 (GRCm39) missense probably benign 0.41
R8428:Dnah6 UTSW 6 73,051,634 (GRCm39) missense probably benign 0.15
R8447:Dnah6 UTSW 6 73,115,757 (GRCm39) missense probably damaging 0.99
R8450:Dnah6 UTSW 6 73,172,798 (GRCm39) missense probably benign 0.41
R8517:Dnah6 UTSW 6 73,155,440 (GRCm39) missense probably benign 0.16
R8523:Dnah6 UTSW 6 73,072,171 (GRCm39) missense probably damaging 1.00
R8691:Dnah6 UTSW 6 73,145,850 (GRCm39) missense probably damaging 1.00
R8700:Dnah6 UTSW 6 73,052,873 (GRCm39) intron probably benign
R8737:Dnah6 UTSW 6 73,044,428 (GRCm39) missense possibly damaging 0.83
R8762:Dnah6 UTSW 6 73,156,811 (GRCm39) missense possibly damaging 0.83
R8804:Dnah6 UTSW 6 73,042,756 (GRCm39) missense probably benign
R8809:Dnah6 UTSW 6 73,009,546 (GRCm39) missense possibly damaging 0.94
R8813:Dnah6 UTSW 6 73,104,937 (GRCm39) missense probably damaging 1.00
R8849:Dnah6 UTSW 6 73,121,156 (GRCm39) critical splice acceptor site probably null
R8867:Dnah6 UTSW 6 72,998,131 (GRCm39) missense probably damaging 1.00
R8882:Dnah6 UTSW 6 73,155,481 (GRCm39) missense probably benign 0.05
R8973:Dnah6 UTSW 6 73,121,734 (GRCm39) missense probably benign 0.39
R9049:Dnah6 UTSW 6 73,119,275 (GRCm39) missense probably damaging 1.00
R9053:Dnah6 UTSW 6 73,061,640 (GRCm39) missense possibly damaging 0.94
R9064:Dnah6 UTSW 6 73,126,156 (GRCm39) missense probably benign 0.00
R9077:Dnah6 UTSW 6 73,121,029 (GRCm39) nonsense probably null
R9102:Dnah6 UTSW 6 73,044,469 (GRCm39) missense probably benign
R9106:Dnah6 UTSW 6 73,121,752 (GRCm39) missense probably damaging 1.00
R9119:Dnah6 UTSW 6 73,037,186 (GRCm39) missense possibly damaging 0.95
R9124:Dnah6 UTSW 6 73,098,882 (GRCm39) missense possibly damaging 0.78
R9165:Dnah6 UTSW 6 73,121,924 (GRCm39) missense probably damaging 1.00
R9182:Dnah6 UTSW 6 73,121,688 (GRCm39) nonsense probably null
R9200:Dnah6 UTSW 6 73,004,497 (GRCm39) missense probably benign 0.06
R9265:Dnah6 UTSW 6 73,060,040 (GRCm39) missense probably benign 0.02
R9368:Dnah6 UTSW 6 72,998,261 (GRCm39) missense probably benign 0.22
R9378:Dnah6 UTSW 6 73,189,513 (GRCm39) missense probably benign
R9439:Dnah6 UTSW 6 73,012,330 (GRCm39) missense possibly damaging 0.66
R9506:Dnah6 UTSW 6 73,119,299 (GRCm39) missense probably damaging 1.00
R9645:Dnah6 UTSW 6 73,115,750 (GRCm39) missense possibly damaging 0.82
R9731:Dnah6 UTSW 6 73,168,589 (GRCm39) missense probably benign 0.00
RF002:Dnah6 UTSW 6 73,078,872 (GRCm39) missense probably benign
RF020:Dnah6 UTSW 6 73,095,040 (GRCm39) missense probably benign 0.00
W0251:Dnah6 UTSW 6 73,155,501 (GRCm39) missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73,168,483 (GRCm39) missense probably benign 0.01
X0025:Dnah6 UTSW 6 73,014,656 (GRCm39) missense probably damaging 1.00
Z1176:Dnah6 UTSW 6 73,110,542 (GRCm39) missense probably benign
Z1176:Dnah6 UTSW 6 73,064,766 (GRCm39) missense possibly damaging 0.79
Z1177:Dnah6 UTSW 6 73,009,509 (GRCm39) missense probably damaging 0.99
Z1177:Dnah6 UTSW 6 72,998,220 (GRCm39) missense probably benign 0.13
Z1177:Dnah6 UTSW 6 73,132,255 (GRCm39) missense possibly damaging 0.92
Z1177:Dnah6 UTSW 6 73,018,121 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATAGACTCTCTGGTGTC -3'
(R):5'- TGTGATGCTGAAACCCTTTGATC -3'

Sequencing Primer
(F):5'- AAAGCCTTTATGCAGGGCTG -3'
(R):5'- GAAACCCTTTGATCTAAAAGCCTCTG -3'
Posted On 2019-10-24