Incidental Mutation 'R7622:Uba2'
ID 589194
Institutional Source Beutler Lab
Gene Symbol Uba2
Ensembl Gene ENSMUSG00000052997
Gene Name ubiquitin-like modifier activating enzyme 2
Synonyms SAE2, anthracycline-associated resistance, Uble1b, Arx, UBA2, Sumo-1 activating enzyme subunit 2
MMRRC Submission 045717-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7622 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 33840121-33868014 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 33864860 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 63 (F63L)
Ref Sequence ENSEMBL: ENSMUSP00000099807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102746] [ENSMUST00000156253] [ENSMUST00000175991]
AlphaFold Q9Z1F9
Predicted Effect probably damaging
Transcript: ENSMUST00000102746
AA Change: F63L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099807
Gene: ENSMUSG00000052997
AA Change: F63L

DomainStartEndE-ValueType
Pfam:ThiF 3 442 5.8e-77 PFAM
Pfam:UAE_UbL 450 537 5.6e-27 PFAM
Pfam:UBA2_C 547 634 8.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134856
Predicted Effect probably damaging
Transcript: ENSMUST00000156253
AA Change: F41L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116605
Gene: ENSMUSG00000052997
AA Change: F41L

DomainStartEndE-ValueType
Pfam:ThiF 10 119 1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175991
SMART Domains Protein: ENSMUSP00000135885
Gene: ENSMUSG00000052997

DomainStartEndE-ValueType
Pfam:UBA_e1_thiolCys 31 75 5.3e-26 PFAM
low complexity region 88 105 N/A INTRINSIC
Meta Mutation Damage Score 0.9613 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 (MIM 613294) and UBA2 form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 G A 5: 129,216,688 (GRCm39) D384N probably benign Het
Aqp8 T C 7: 123,065,883 (GRCm39) F226S possibly damaging Het
Arl6ip6 A G 2: 53,107,339 (GRCm39) Y207C probably damaging Het
Bltp1 C A 3: 37,002,562 (GRCm39) C1502* probably null Het
Cbfa2t2 A G 2: 154,342,365 (GRCm39) E27G possibly damaging Het
Cdc42bpb T G 12: 111,261,206 (GRCm39) E201A unknown Het
Cfap54 A C 10: 92,792,806 (GRCm39) V1769G unknown Het
Dmxl2 C T 9: 54,379,502 (GRCm39) G7S probably damaging Het
Dnah6 G T 6: 73,101,742 (GRCm39) F1927L possibly damaging Het
Dnajc6 A G 4: 101,497,688 (GRCm39) E942G probably damaging Het
Fam170a A G 18: 50,415,969 (GRCm39) R324G probably benign Het
Gapdhs G A 7: 30,438,756 (GRCm39) T9I unknown Het
Gm10320 T A 13: 98,626,232 (GRCm39) R51* probably null Het
Gm19410 A T 8: 36,277,501 (GRCm39) T1776S possibly damaging Het
Gm4846 A T 1: 166,323,441 (GRCm39) M94K possibly damaging Het
Ighv2-5 G A 12: 113,649,358 (GRCm39) Q32* probably null Het
Klc2 T C 19: 5,161,660 (GRCm39) E310G probably damaging Het
Krt75 A G 15: 101,478,707 (GRCm39) M309T probably damaging Het
Lrp11 G A 10: 7,465,936 (GRCm39) G41R unknown Het
Lrrc52 G T 1: 167,293,664 (GRCm39) P207Q probably benign Het
Lrrc52 G T 1: 167,293,665 (GRCm39) P207T probably benign Het
Lrrk2 A T 15: 91,696,526 (GRCm39) D2438V probably damaging Het
Mycbp C T 4: 123,799,094 (GRCm39) T28M probably damaging Het
Myh14 A G 7: 44,281,846 (GRCm39) V804A probably benign Het
Myo16 A G 8: 10,426,238 (GRCm39) I332V unknown Het
Ncor1 G T 11: 62,208,794 (GRCm39) Q1359K probably benign Het
Oog3 T C 4: 143,884,889 (GRCm39) D349G probably benign Het
Or12e1 A T 2: 87,022,594 (GRCm39) I188L probably benign Het
Or1j21 A G 2: 36,683,943 (GRCm39) K232E probably benign Het
Or52b4i A G 7: 102,191,830 (GRCm39) H229R probably benign Het
Or8k53 A G 2: 86,178,006 (GRCm39) Y35H possibly damaging Het
Pate4 A G 9: 35,519,595 (GRCm39) S32P possibly damaging Het
Pcdhb7 A C 18: 37,475,514 (GRCm39) S217R probably benign Het
Pde1c G A 6: 56,103,910 (GRCm39) R580C probably damaging Het
Pi4ka C A 16: 17,111,841 (GRCm39) A1545S Het
Pign G T 1: 105,575,842 (GRCm39) T266K possibly damaging Het
Pitpnm2 A G 5: 124,260,090 (GRCm39) I1134T probably benign Het
Ppfia2 G A 10: 106,666,520 (GRCm39) V409I possibly damaging Het
Prr7 A G 13: 55,620,609 (GRCm39) T206A probably benign Het
Rnf13 A T 3: 57,727,955 (GRCm39) R212* probably null Het
Rwdd2b T C 16: 87,231,500 (GRCm39) N218S probably benign Het
Serpina3m A G 12: 104,355,834 (GRCm39) D167G possibly damaging Het
Slit2 A T 5: 48,142,547 (GRCm39) N56Y probably damaging Het
Sprr3 G T 3: 92,364,592 (GRCm39) T84K probably damaging Het
Stab2 A T 10: 86,709,766 (GRCm39) H1626Q possibly damaging Het
Tex2 C A 11: 106,437,721 (GRCm39) D650Y unknown Het
Tmprss6 A G 15: 78,330,926 (GRCm39) S436P probably benign Het
Ubxn2b C T 4: 6,214,692 (GRCm39) S242L probably damaging Het
Vmn1r86 T G 7: 12,836,685 (GRCm39) I64L probably benign Het
Vmn2r67 A T 7: 84,785,662 (GRCm39) V781E probably damaging Het
Vmn2r80 T A 10: 79,030,097 (GRCm39) F641Y probably damaging Het
Wdfy4 A T 14: 32,800,231 (GRCm39) I1965K Het
Wdr25 G A 12: 108,958,819 (GRCm39) G344S possibly damaging Het
Wdr90 G T 17: 26,073,083 (GRCm39) F837L probably benign Het
Xpo4 A G 14: 57,834,468 (GRCm39) V704A possibly damaging Het
Zc3h12d A G 10: 7,743,033 (GRCm39) K268E probably damaging Het
Other mutations in Uba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Uba2 APN 7 33,858,294 (GRCm39) missense probably damaging 1.00
IGL01593:Uba2 APN 7 33,845,689 (GRCm39) missense probably damaging 0.96
IGL02268:Uba2 APN 7 33,842,161 (GRCm39) critical splice donor site probably null
IGL03399:Uba2 APN 7 33,843,939 (GRCm39) missense probably damaging 1.00
Divided UTSW 7 33,864,860 (GRCm39) missense probably damaging 1.00
Minus UTSW 7 33,845,687 (GRCm39) nonsense probably null
Subtracted UTSW 7 33,850,239 (GRCm39) missense possibly damaging 0.65
R0242:Uba2 UTSW 7 33,854,054 (GRCm39) missense possibly damaging 0.92
R0242:Uba2 UTSW 7 33,854,054 (GRCm39) missense possibly damaging 0.92
R0270:Uba2 UTSW 7 33,850,281 (GRCm39) missense possibly damaging 0.95
R0390:Uba2 UTSW 7 33,850,446 (GRCm39) missense probably benign 0.10
R0603:Uba2 UTSW 7 33,861,038 (GRCm39) missense probably damaging 1.00
R1066:Uba2 UTSW 7 33,858,247 (GRCm39) missense probably damaging 1.00
R1806:Uba2 UTSW 7 33,862,624 (GRCm39) missense probably damaging 0.99
R1813:Uba2 UTSW 7 33,850,455 (GRCm39) missense probably damaging 1.00
R1896:Uba2 UTSW 7 33,850,455 (GRCm39) missense probably damaging 1.00
R2210:Uba2 UTSW 7 33,862,587 (GRCm39) missense probably damaging 1.00
R3618:Uba2 UTSW 7 33,853,907 (GRCm39) critical splice donor site probably null
R3779:Uba2 UTSW 7 33,854,071 (GRCm39) critical splice acceptor site probably null
R3793:Uba2 UTSW 7 33,845,722 (GRCm39) missense probably damaging 0.97
R4607:Uba2 UTSW 7 33,854,021 (GRCm39) missense probably damaging 1.00
R4608:Uba2 UTSW 7 33,854,021 (GRCm39) missense probably damaging 1.00
R5938:Uba2 UTSW 7 33,864,915 (GRCm39) splice site probably null
R6404:Uba2 UTSW 7 33,853,985 (GRCm39) missense probably damaging 0.98
R7050:Uba2 UTSW 7 33,845,687 (GRCm39) nonsense probably null
R7181:Uba2 UTSW 7 33,840,854 (GRCm39) missense probably benign 0.01
R7369:Uba2 UTSW 7 33,850,239 (GRCm39) missense possibly damaging 0.65
R7727:Uba2 UTSW 7 33,850,275 (GRCm39) missense probably damaging 0.99
R7807:Uba2 UTSW 7 33,862,638 (GRCm39) missense possibly damaging 0.91
R8038:Uba2 UTSW 7 33,847,022 (GRCm39) missense probably damaging 1.00
R8057:Uba2 UTSW 7 33,867,835 (GRCm39) missense possibly damaging 0.80
R8120:Uba2 UTSW 7 33,867,812 (GRCm39) missense probably benign
R8253:Uba2 UTSW 7 33,850,323 (GRCm39) missense probably damaging 0.96
R8961:Uba2 UTSW 7 33,855,642 (GRCm39) intron probably benign
R8988:Uba2 UTSW 7 33,853,987 (GRCm39) missense probably benign
R9672:Uba2 UTSW 7 33,856,749 (GRCm39) missense probably benign 0.29
X0026:Uba2 UTSW 7 33,853,904 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- CTTTGGGATTCAAGAGGTAGGC -3'
(R):5'- AACAATTGGGTGTGAGTTGTCC -3'

Sequencing Primer
(F):5'- TTCCCATGCAAATGATGTGCAC -3'
(R):5'- TTGTCCAGGAAAGCACTGGC -3'
Posted On 2019-10-24