Mutagenetix > Incidental Mutation

Incidental Mutation 'R7622:Vmn2r67'

589196

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r67

Ensembl Gene

ENSMUSG00000095664

Gene Name

vomeronasal 2, receptor 67

Synonyms

EG620672

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R7622 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85136240-85155902 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85136454 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 781 (V781E)

Ref Sequence

ENSEMBL: ENSMUSP00000126007 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168730]

AlphaFold

K7N6T2

Predicted Effect

probably damaging
Transcript: ENSMUST00000168730
AA Change: V781E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126007
Gene: ENSMUSG00000095664
AA Change: V781E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:ANF_receptor	77	464	2.1e-31	PFAM
Pfam:NCD3G	507	559	4.8e-19	PFAM
Pfam:7tm_3	590	827	1.4e-53	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (55/56)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,948,413	C1502*	probably null	Het
Adgrd1	G	A	5: 129,139,624	D384N	probably benign	Het
Aqp8	T	C	7: 123,466,660	F226S	possibly damaging	Het
Arl6ip6	A	G	2: 53,217,327	Y207C	probably damaging	Het
Cbfa2t2	A	G	2: 154,500,445	E27G	possibly damaging	Het
Cdc42bpb	T	G	12: 111,294,772	E201A	unknown	Het
Cfap54	A	C	10: 92,956,944	V1769G	unknown	Het
Dmxl2	C	T	9: 54,472,218	G7S	probably damaging	Het
Dnah6	G	T	6: 73,124,759	F1927L	possibly damaging	Het
Dnajc6	A	G	4: 101,640,491	E942G	probably damaging	Het
Fam170a	A	G	18: 50,282,902	R324G	probably benign	Het
Gapdhs	G	A	7: 30,739,331	T9I	unknown	Het
Gm10320	T	A	13: 98,489,724	R51*	probably null	Het
Gm19410	A	T	8: 35,810,347	T1776S	possibly damaging	Het
Gm4846	A	T	1: 166,495,872	M94K	possibly damaging	Het
Ighv2-5	G	A	12: 113,685,738	Q32*	probably null	Het
Klc2	T	C	19: 5,111,632	E310G	probably damaging	Het
Krt75	A	G	15: 101,570,272	M309T	probably damaging	Het
Lrp11	G	A	10: 7,590,172	G41R	unknown	Het
Lrrc52	G	T	1: 167,466,095	P207Q	probably benign	Het
Lrrc52	G	T	1: 167,466,096	P207T	probably benign	Het
Lrrk2	A	T	15: 91,812,323	D2438V	probably damaging	Het
Mycbp	C	T	4: 123,905,301	T28M	probably damaging	Het
Myh14	A	G	7: 44,632,422	V804A	probably benign	Het
Myo16	A	G	8: 10,376,238	I332V	unknown	Het
Ncor1	G	T	11: 62,317,968	Q1359K	probably benign	Het
Olfr1055	A	G	2: 86,347,662	Y35H	possibly damaging	Het
Olfr1112	A	T	2: 87,192,250	I188L	probably benign	Het
Olfr50	A	G	2: 36,793,931	K232E	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,623	H229R	probably benign	Het
Oog3	T	C	4: 144,158,319	D349G	probably benign	Het
Pate4	A	G	9: 35,608,299	S32P	possibly damaging	Het
Pcdhb7	A	C	18: 37,342,461	S217R	probably benign	Het
Pde1c	G	A	6: 56,126,925	R580C	probably damaging	Het
Pi4ka	C	A	16: 17,293,977	A1545S		Het
Pign	G	T	1: 105,648,117	T266K	possibly damaging	Het
Pitpnm2	A	G	5: 124,122,027	I1134T	probably benign	Het
Ppfia2	G	A	10: 106,830,659	V409I	possibly damaging	Het
Prr7	A	G	13: 55,472,796	T206A	probably benign	Het
Rnf13	A	T	3: 57,820,534	R212*	probably null	Het
Rwdd2b	T	C	16: 87,434,612	N218S	probably benign	Het
Serpina3m	A	G	12: 104,389,575	D167G	possibly damaging	Het
Slit2	A	T	5: 47,985,205	N56Y	probably damaging	Het
Sprr3	G	T	3: 92,457,285	T84K	probably damaging	Het
Stab2	A	T	10: 86,873,902	H1626Q	possibly damaging	Het
Tex2	C	A	11: 106,546,895	D650Y	unknown	Het
Tmprss6	A	G	15: 78,446,726	S436P	probably benign	Het
Uba2	A	C	7: 34,165,435	F63L	probably damaging	Het
Ubxn2b	C	T	4: 6,214,692	S242L	probably damaging	Het
Vmn1r86	T	G	7: 13,102,758	I64L	probably benign	Het
Vmn2r80	T	A	10: 79,194,263	F641Y	probably damaging	Het
Wdfy4	A	T	14: 33,078,274	I1965K		Het
Wdr25	G	A	12: 108,992,893	G344S	possibly damaging	Het
Wdr90	G	T	17: 25,854,109	F837L	probably benign	Het
Xpo4	A	G	14: 57,597,011	V704A	possibly damaging	Het
Zc3h12d	A	G	10: 7,867,269	K268E	probably damaging	Het

Other mutations in Vmn2r67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Vmn2r67	APN	7	85151930	missense	probably damaging	1.00
IGL01346:Vmn2r67	APN	7	85136919	missense	probably damaging	1.00
IGL01373:Vmn2r67	APN	7	85136626	missense	probably benign	0.10
IGL01674:Vmn2r67	APN	7	85136443	missense	probably damaging	1.00
IGL01978:Vmn2r67	APN	7	85151441	critical splice donor site	probably null
IGL02013:Vmn2r67	APN	7	85151655	missense	probably benign	0.09
IGL02115:Vmn2r67	APN	7	85151579	missense	probably damaging	0.99
IGL02250:Vmn2r67	APN	7	85155800	missense	probably benign
IGL02252:Vmn2r67	APN	7	85155800	missense	probably benign
IGL02328:Vmn2r67	APN	7	85150690	missense	probably benign	0.41
IGL02740:Vmn2r67	APN	7	85136610	missense	probably damaging	1.00
IGL02940:Vmn2r67	APN	7	85136743	missense	probably benign	0.07
IGL03237:Vmn2r67	APN	7	85149910	missense	probably damaging	1.00
R0512:Vmn2r67	UTSW	7	85150692	missense	probably damaging	1.00
R1029:Vmn2r67	UTSW	7	85136766	missense	probably damaging	1.00
R1193:Vmn2r67	UTSW	7	85151445	missense	probably damaging	0.98
R1282:Vmn2r67	UTSW	7	85136724	missense	probably benign
R1416:Vmn2r67	UTSW	7	85151616	missense	probably benign	0.06
R1429:Vmn2r67	UTSW	7	85152823	missense	possibly damaging	0.65
R1462:Vmn2r67	UTSW	7	85155838	missense	probably benign	0.00
R1462:Vmn2r67	UTSW	7	85155838	missense	probably benign	0.00
R1970:Vmn2r67	UTSW	7	85151805	missense	probably benign
R2229:Vmn2r67	UTSW	7	85152042	missense	probably benign	0.21
R2246:Vmn2r67	UTSW	7	85136556	missense	probably damaging	1.00
R2262:Vmn2r67	UTSW	7	85136974	missense	probably damaging	0.96
R2398:Vmn2r67	UTSW	7	85136713	missense	probably damaging	1.00
R4249:Vmn2r67	UTSW	7	85150514	splice site	probably null
R4666:Vmn2r67	UTSW	7	85150623	missense	probably benign
R4669:Vmn2r67	UTSW	7	85150524	missense	probably benign	0.11
R4966:Vmn2r67	UTSW	7	85136385	missense	probably damaging	1.00
R5264:Vmn2r67	UTSW	7	85152245	missense	probably damaging	1.00
R5296:Vmn2r67	UTSW	7	85137022	missense	probably damaging	1.00
R5327:Vmn2r67	UTSW	7	85136490	missense	probably damaging	1.00
R5401:Vmn2r67	UTSW	7	85136557	missense	probably damaging	1.00
R5510:Vmn2r67	UTSW	7	85151815	missense	probably benign	0.39
R5574:Vmn2r67	UTSW	7	85151891	missense	probably benign	0.00
R5643:Vmn2r67	UTSW	7	85149943	nonsense	probably null
R5914:Vmn2r67	UTSW	7	85151836	missense	probably damaging	1.00
R6248:Vmn2r67	UTSW	7	85150560	missense	probably damaging	0.99
R6291:Vmn2r67	UTSW	7	85149934	missense	possibly damaging	0.88
R6309:Vmn2r67	UTSW	7	85151916	missense	probably benign
R6442:Vmn2r67	UTSW	7	85155838	missense	possibly damaging	0.82
R6665:Vmn2r67	UTSW	7	85136692	missense	probably benign	0.07
R6701:Vmn2r67	UTSW	7	85152815	missense	probably damaging	1.00
R6848:Vmn2r67	UTSW	7	85152632	missense	probably benign	0.00
R6852:Vmn2r67	UTSW	7	85152153	missense	probably damaging	0.99
R6991:Vmn2r67	UTSW	7	85155745	missense	possibly damaging	0.55
R7143:Vmn2r67	UTSW	7	85152638	missense	probably benign
R7197:Vmn2r67	UTSW	7	85136566	missense	possibly damaging	0.77
R7393:Vmn2r67	UTSW	7	85155878	missense	probably null	0.87
R7420:Vmn2r67	UTSW	7	85136736	missense	possibly damaging	0.52
R7664:Vmn2r67	UTSW	7	85155811	missense	probably benign	0.21
R7665:Vmn2r67	UTSW	7	85151988	nonsense	probably null
R7896:Vmn2r67	UTSW	7	85136712	missense	probably damaging	1.00
R7913:Vmn2r67	UTSW	7	85151828	missense	possibly damaging	0.87
R8026:Vmn2r67	UTSW	7	85136716	missense	probably damaging	1.00
R8114:Vmn2r67	UTSW	7	85155889	missense	probably benign	0.01
R8317:Vmn2r67	UTSW	7	85136626	missense	probably benign	0.10
R8363:Vmn2r67	UTSW	7	85155761	missense	probably benign	0.00
R8421:Vmn2r67	UTSW	7	85136685	missense	probably damaging	0.98
R8444:Vmn2r67	UTSW	7	85136646	missense	probably benign	0.01
R8751:Vmn2r67	UTSW	7	85152242	missense	probably benign	0.01
R8810:Vmn2r67	UTSW	7	85137138	missense	probably damaging	1.00
R8811:Vmn2r67	UTSW	7	85150687	missense	probably damaging	0.98
R9215:Vmn2r67	UTSW	7	85152800	missense	probably benign	0.00
R9342:Vmn2r67	UTSW	7	85136580	missense	probably benign	0.00
R9433:Vmn2r67	UTSW	7	85155709	missense	possibly damaging	0.60
R9453:Vmn2r67	UTSW	7	85151489	missense	probably benign	0.32
R9471:Vmn2r67	UTSW	7	85150515	critical splice donor site	probably null
R9526:Vmn2r67	UTSW	7	85136626	missense	probably benign	0.10
R9538:Vmn2r67	UTSW	7	85152119	missense
R9544:Vmn2r67	UTSW	7	85137109	missense	possibly damaging	0.53
R9574:Vmn2r67	UTSW	7	85136809	missense	probably benign	0.00
R9599:Vmn2r67	UTSW	7	85155733	missense	probably damaging	0.96
R9768:Vmn2r67	UTSW	7	85152829	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- CAACAAACTGAGGTCCAGGTG -3'
(R):5'- TGGTACATGGCCACATCATTATTG -3'

Sequencing Primer
(F):5'- AACAAACTGAGGTCCAGGTGTTTTG -3'
(R):5'- GTTTGCAACAAAGGTTCAGTGATTGC -3'

Posted On

2019-10-24