Mutagenetix > Incidental Mutation

Incidental Mutation 'R7622:Gm19410'

589200

Institutional Source

Beutler Lab

Gene Symbol

Gm19410

Ensembl Gene

ENSMUSG00000109372

Gene Name

predicted gene, 19410

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R7622 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35765790-35818047 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 35810347 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1776 (T1776S)

Ref Sequence

ENSEMBL: ENSMUSP00000147162 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000207505]

AlphaFold

A0A140LJC7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207505
AA Change: T1776S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (55/56)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,948,413	C1502*	probably null	Het
Adgrd1	G	A	5: 129,139,624	D384N	probably benign	Het
Aqp8	T	C	7: 123,466,660	F226S	possibly damaging	Het
Arl6ip6	A	G	2: 53,217,327	Y207C	probably damaging	Het
Cbfa2t2	A	G	2: 154,500,445	E27G	possibly damaging	Het
Cdc42bpb	T	G	12: 111,294,772	E201A	unknown	Het
Cfap54	A	C	10: 92,956,944	V1769G	unknown	Het
Dmxl2	C	T	9: 54,472,218	G7S	probably damaging	Het
Dnah6	G	T	6: 73,124,759	F1927L	possibly damaging	Het
Dnajc6	A	G	4: 101,640,491	E942G	probably damaging	Het
Fam170a	A	G	18: 50,282,902	R324G	probably benign	Het
Gapdhs	G	A	7: 30,739,331	T9I	unknown	Het
Gm10320	T	A	13: 98,489,724	R51*	probably null	Het
Gm4846	A	T	1: 166,495,872	M94K	possibly damaging	Het
Ighv2-5	G	A	12: 113,685,738	Q32*	probably null	Het
Klc2	T	C	19: 5,111,632	E310G	probably damaging	Het
Krt75	A	G	15: 101,570,272	M309T	probably damaging	Het
Lrp11	G	A	10: 7,590,172	G41R	unknown	Het
Lrrc52	G	T	1: 167,466,095	P207Q	probably benign	Het
Lrrc52	G	T	1: 167,466,096	P207T	probably benign	Het
Lrrk2	A	T	15: 91,812,323	D2438V	probably damaging	Het
Mycbp	C	T	4: 123,905,301	T28M	probably damaging	Het
Myh14	A	G	7: 44,632,422	V804A	probably benign	Het
Myo16	A	G	8: 10,376,238	I332V	unknown	Het
Ncor1	G	T	11: 62,317,968	Q1359K	probably benign	Het
Olfr1055	A	G	2: 86,347,662	Y35H	possibly damaging	Het
Olfr1112	A	T	2: 87,192,250	I188L	probably benign	Het
Olfr50	A	G	2: 36,793,931	K232E	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,623	H229R	probably benign	Het
Oog3	T	C	4: 144,158,319	D349G	probably benign	Het
Pate4	A	G	9: 35,608,299	S32P	possibly damaging	Het
Pcdhb7	A	C	18: 37,342,461	S217R	probably benign	Het
Pde1c	G	A	6: 56,126,925	R580C	probably damaging	Het
Pi4ka	C	A	16: 17,293,977	A1545S		Het
Pign	G	T	1: 105,648,117	T266K	possibly damaging	Het
Pitpnm2	A	G	5: 124,122,027	I1134T	probably benign	Het
Ppfia2	G	A	10: 106,830,659	V409I	possibly damaging	Het
Prr7	A	G	13: 55,472,796	T206A	probably benign	Het
Rnf13	A	T	3: 57,820,534	R212*	probably null	Het
Rwdd2b	T	C	16: 87,434,612	N218S	probably benign	Het
Serpina3m	A	G	12: 104,389,575	D167G	possibly damaging	Het
Slit2	A	T	5: 47,985,205	N56Y	probably damaging	Het
Sprr3	G	T	3: 92,457,285	T84K	probably damaging	Het
Stab2	A	T	10: 86,873,902	H1626Q	possibly damaging	Het
Tex2	C	A	11: 106,546,895	D650Y	unknown	Het
Tmprss6	A	G	15: 78,446,726	S436P	probably benign	Het
Uba2	A	C	7: 34,165,435	F63L	probably damaging	Het
Ubxn2b	C	T	4: 6,214,692	S242L	probably damaging	Het
Vmn1r86	T	G	7: 13,102,758	I64L	probably benign	Het
Vmn2r67	A	T	7: 85,136,454	V781E	probably damaging	Het
Vmn2r80	T	A	10: 79,194,263	F641Y	probably damaging	Het
Wdfy4	A	T	14: 33,078,274	I1965K		Het
Wdr25	G	A	12: 108,992,893	G344S	possibly damaging	Het
Wdr90	G	T	17: 25,854,109	F837L	probably benign	Het
Xpo4	A	G	14: 57,597,011	V704A	possibly damaging	Het
Zc3h12d	A	G	10: 7,867,269	K268E	probably damaging	Het

Other mutations in Gm19410

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
BB009:Gm19410	UTSW	8	35795599	missense	probably damaging	0.98
BB019:Gm19410	UTSW	8	35795599	missense	probably damaging	0.98
R0046:Gm19410	UTSW	8	35802645	missense	probably benign	0.31
R6026:Gm19410	UTSW	8	35812426	missense	probably benign	0.03
R6039:Gm19410	UTSW	8	35809364	missense	probably benign	0.44
R6039:Gm19410	UTSW	8	35809364	missense	probably benign	0.44
R6185:Gm19410	UTSW	8	35807510	missense	possibly damaging	0.87
R6239:Gm19410	UTSW	8	35778764	missense	probably damaging	0.98
R6303:Gm19410	UTSW	8	35807560	missense	possibly damaging	0.96
R6377:Gm19410	UTSW	8	35803582	nonsense	probably null
R6545:Gm19410	UTSW	8	35790498	missense	possibly damaging	0.93
R6700:Gm19410	UTSW	8	35807510	missense	possibly damaging	0.87
R6720:Gm19410	UTSW	8	35807576	missense	probably benign	0.12
R6795:Gm19410	UTSW	8	35795522	missense	probably damaging	0.98
R6808:Gm19410	UTSW	8	35772579	missense	probably damaging	0.99
R6810:Gm19410	UTSW	8	35772579	missense	probably damaging	0.99
R6811:Gm19410	UTSW	8	35772579	missense	probably damaging	0.99
R6966:Gm19410	UTSW	8	35817973	missense	possibly damaging	0.84
R7264:Gm19410	UTSW	8	35785766	missense	probably benign	0.01
R7267:Gm19410	UTSW	8	35814843	missense	possibly damaging	0.80
R7355:Gm19410	UTSW	8	35807072	missense	probably benign	0.00
R7423:Gm19410	UTSW	8	35804607	missense	probably benign	0.28
R7494:Gm19410	UTSW	8	35795530	missense	probably damaging	0.99
R7516:Gm19410	UTSW	8	35796279	missense	probably benign	0.30
R7517:Gm19410	UTSW	8	35773618	missense	possibly damaging	0.45
R7526:Gm19410	UTSW	8	35790612	missense	probably damaging	0.98
R7527:Gm19410	UTSW	8	35802232	missense	probably damaging	0.99
R7545:Gm19410	UTSW	8	35802625	missense	probably damaging	0.99
R7549:Gm19410	UTSW	8	35799346	missense	probably benign	0.20
R7564:Gm19410	UTSW	8	35806997	missense	probably benign	0.00
R7615:Gm19410	UTSW	8	35796359	missense	probably damaging	1.00
R7655:Gm19410	UTSW	8	35809099	missense	probably benign
R7656:Gm19410	UTSW	8	35809099	missense	probably benign
R7703:Gm19410	UTSW	8	35799385	missense	probably damaging	0.98
R7750:Gm19410	UTSW	8	35807498	missense	possibly damaging	0.68
R7760:Gm19410	UTSW	8	35802337	missense	probably damaging	0.99
R7837:Gm19410	UTSW	8	35808980	missense	possibly damaging	0.91
R7932:Gm19410	UTSW	8	35795599	missense	probably damaging	0.98
R7942:Gm19410	UTSW	8	35771786	missense	probably damaging	0.98
R7970:Gm19410	UTSW	8	35815647	missense	probably benign	0.00
R8088:Gm19410	UTSW	8	35806841	missense	probably benign	0.45
R8228:Gm19410	UTSW	8	35785838	missense	possibly damaging	0.53
R8382:Gm19410	UTSW	8	35809148	missense	probably damaging	0.99
R8757:Gm19410	UTSW	8	35808965	missense	possibly damaging	0.83
R8879:Gm19410	UTSW	8	35771868	missense	probably damaging	0.99
R9010:Gm19410	UTSW	8	35814857	missense	probably benign	0.02
R9060:Gm19410	UTSW	8	35802326	missense	probably damaging	1.00
R9088:Gm19410	UTSW	8	35773612	missense	probably damaging	1.00
R9104:Gm19410	UTSW	8	35780467	missense	probably damaging	0.99
R9186:Gm19410	UTSW	8	35815475	missense	possibly damaging	0.90
R9290:Gm19410	UTSW	8	35802232	missense	probably damaging	0.99
R9334:Gm19410	UTSW	8	35803568	nonsense	probably null
R9398:Gm19410	UTSW	8	35805202	missense	probably benign	0.00
R9439:Gm19410	UTSW	8	35781656	missense	probably damaging	0.96
R9445:Gm19410	UTSW	8	35772498	missense	possibly damaging	0.75
R9511:Gm19410	UTSW	8	35790694	missense	probably damaging	0.99
R9520:Gm19410	UTSW	8	35795483	missense	probably benign	0.15
R9523:Gm19410	UTSW	8	35790454	missense	probably benign	0.01
R9669:Gm19410	UTSW	8	35780339	missense	possibly damaging	0.45
R9711:Gm19410	UTSW	8	35812339	missense	possibly damaging	0.85
R9728:Gm19410	UTSW	8	35780440	missense	possibly damaging	0.95
R9759:Gm19410	UTSW	8	35785784	missense	possibly damaging	0.53
Z1176:Gm19410	UTSW	8	35792611	missense	possibly damaging	0.79
Z1177:Gm19410	UTSW	8	35808965	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ATCCTGAAGCTGGAACAAGACA -3'
(R):5'- ATTGCAGGACCTAAGCTTTATCA -3'

Sequencing Primer
(F):5'- AGACATAACAGTCTTCAGGATGTAG -3'
(R):5'- TTGAGGACCACTGATGCAG -3'

Posted On

2019-10-24