Incidental Mutation 'R7622:Dmxl2'
ID 589202
Institutional Source Beutler Lab
Gene Symbol Dmxl2
Ensembl Gene ENSMUSG00000041268
Gene Name Dmx-like 2
Synonyms E130119P06Rik, 6430411K14Rik
MMRRC Submission 045717-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7622 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 54272442-54408910 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 54379502 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 7 (G7S)
Ref Sequence ENSEMBL: ENSMUSP00000122293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600] [ENSMUST00000127880]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000118163
AA Change: G181S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268
AA Change: G181S

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
Pfam:Rav1p_C 1430 1903 1.5e-71 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2472 2490 N/A INTRINSIC
low complexity region 2635 2649 N/A INTRINSIC
low complexity region 2744 2766 N/A INTRINSIC
WD40 2774 2809 5.73e0 SMART
WD40 2813 2852 8.88e0 SMART
WD40 2859 2901 2.67e-1 SMART
WD40 2907 2946 2.57e-2 SMART
WD40 2949 2988 3.61e-6 SMART
WD40 3001 3039 8.25e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118600
AA Change: G181S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268
AA Change: G181S

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
low complexity region 1426 1436 N/A INTRINSIC
Pfam:Rav1p_C 1447 1903 4.2e-68 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2471 2489 N/A INTRINSIC
low complexity region 2722 2744 N/A INTRINSIC
WD40 2752 2787 5.73e0 SMART
WD40 2791 2830 8.88e0 SMART
WD40 2837 2879 2.67e-1 SMART
WD40 2885 2924 2.57e-2 SMART
WD40 2927 2966 3.61e-6 SMART
WD40 2979 3017 8.25e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127880
AA Change: G7S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122293
Gene: ENSMUSG00000041268
AA Change: G7S

DomainStartEndE-ValueType
Pfam:WD40 1 24 7.9e-4 PFAM
WD40 47 95 1.03e-1 SMART
low complexity region 246 266 N/A INTRINSIC
WD40 567 619 1.42e2 SMART
low complexity region 687 701 N/A INTRINSIC
low complexity region 771 787 N/A INTRINSIC
WD40 811 855 1.15e1 SMART
WD40 1062 1099 2.84e2 SMART
low complexity region 1252 1262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 G A 5: 129,216,688 (GRCm39) D384N probably benign Het
Aqp8 T C 7: 123,065,883 (GRCm39) F226S possibly damaging Het
Arl6ip6 A G 2: 53,107,339 (GRCm39) Y207C probably damaging Het
Bltp1 C A 3: 37,002,562 (GRCm39) C1502* probably null Het
Cbfa2t2 A G 2: 154,342,365 (GRCm39) E27G possibly damaging Het
Cdc42bpb T G 12: 111,261,206 (GRCm39) E201A unknown Het
Cfap54 A C 10: 92,792,806 (GRCm39) V1769G unknown Het
Dnah6 G T 6: 73,101,742 (GRCm39) F1927L possibly damaging Het
Dnajc6 A G 4: 101,497,688 (GRCm39) E942G probably damaging Het
Fam170a A G 18: 50,415,969 (GRCm39) R324G probably benign Het
Gapdhs G A 7: 30,438,756 (GRCm39) T9I unknown Het
Gm10320 T A 13: 98,626,232 (GRCm39) R51* probably null Het
Gm19410 A T 8: 36,277,501 (GRCm39) T1776S possibly damaging Het
Gm4846 A T 1: 166,323,441 (GRCm39) M94K possibly damaging Het
Ighv2-5 G A 12: 113,649,358 (GRCm39) Q32* probably null Het
Klc2 T C 19: 5,161,660 (GRCm39) E310G probably damaging Het
Krt75 A G 15: 101,478,707 (GRCm39) M309T probably damaging Het
Lrp11 G A 10: 7,465,936 (GRCm39) G41R unknown Het
Lrrc52 G T 1: 167,293,664 (GRCm39) P207Q probably benign Het
Lrrc52 G T 1: 167,293,665 (GRCm39) P207T probably benign Het
Lrrk2 A T 15: 91,696,526 (GRCm39) D2438V probably damaging Het
Mycbp C T 4: 123,799,094 (GRCm39) T28M probably damaging Het
Myh14 A G 7: 44,281,846 (GRCm39) V804A probably benign Het
Myo16 A G 8: 10,426,238 (GRCm39) I332V unknown Het
Ncor1 G T 11: 62,208,794 (GRCm39) Q1359K probably benign Het
Oog3 T C 4: 143,884,889 (GRCm39) D349G probably benign Het
Or12e1 A T 2: 87,022,594 (GRCm39) I188L probably benign Het
Or1j21 A G 2: 36,683,943 (GRCm39) K232E probably benign Het
Or52b4i A G 7: 102,191,830 (GRCm39) H229R probably benign Het
Or8k53 A G 2: 86,178,006 (GRCm39) Y35H possibly damaging Het
Pate4 A G 9: 35,519,595 (GRCm39) S32P possibly damaging Het
Pcdhb7 A C 18: 37,475,514 (GRCm39) S217R probably benign Het
Pde1c G A 6: 56,103,910 (GRCm39) R580C probably damaging Het
Pi4ka C A 16: 17,111,841 (GRCm39) A1545S Het
Pign G T 1: 105,575,842 (GRCm39) T266K possibly damaging Het
Pitpnm2 A G 5: 124,260,090 (GRCm39) I1134T probably benign Het
Ppfia2 G A 10: 106,666,520 (GRCm39) V409I possibly damaging Het
Prr7 A G 13: 55,620,609 (GRCm39) T206A probably benign Het
Rnf13 A T 3: 57,727,955 (GRCm39) R212* probably null Het
Rwdd2b T C 16: 87,231,500 (GRCm39) N218S probably benign Het
Serpina3m A G 12: 104,355,834 (GRCm39) D167G possibly damaging Het
Slit2 A T 5: 48,142,547 (GRCm39) N56Y probably damaging Het
Sprr3 G T 3: 92,364,592 (GRCm39) T84K probably damaging Het
Stab2 A T 10: 86,709,766 (GRCm39) H1626Q possibly damaging Het
Tex2 C A 11: 106,437,721 (GRCm39) D650Y unknown Het
Tmprss6 A G 15: 78,330,926 (GRCm39) S436P probably benign Het
Uba2 A C 7: 33,864,860 (GRCm39) F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 (GRCm39) S242L probably damaging Het
Vmn1r86 T G 7: 12,836,685 (GRCm39) I64L probably benign Het
Vmn2r67 A T 7: 84,785,662 (GRCm39) V781E probably damaging Het
Vmn2r80 T A 10: 79,030,097 (GRCm39) F641Y probably damaging Het
Wdfy4 A T 14: 32,800,231 (GRCm39) I1965K Het
Wdr25 G A 12: 108,958,819 (GRCm39) G344S possibly damaging Het
Wdr90 G T 17: 26,073,083 (GRCm39) F837L probably benign Het
Xpo4 A G 14: 57,834,468 (GRCm39) V704A possibly damaging Het
Zc3h12d A G 10: 7,743,033 (GRCm39) K268E probably damaging Het
Other mutations in Dmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dmxl2 APN 9 54,308,988 (GRCm39) missense probably benign
IGL00226:Dmxl2 APN 9 54,323,277 (GRCm39) missense probably damaging 1.00
IGL00419:Dmxl2 APN 9 54,313,951 (GRCm39) missense probably damaging 0.96
IGL00551:Dmxl2 APN 9 54,358,122 (GRCm39) missense probably damaging 1.00
IGL00765:Dmxl2 APN 9 54,322,706 (GRCm39) unclassified probably benign
IGL00852:Dmxl2 APN 9 54,330,597 (GRCm39) nonsense probably null
IGL00857:Dmxl2 APN 9 54,283,604 (GRCm39) missense probably benign 0.32
IGL00952:Dmxl2 APN 9 54,324,166 (GRCm39) missense probably damaging 0.99
IGL01139:Dmxl2 APN 9 54,366,248 (GRCm39) missense probably damaging 1.00
IGL01346:Dmxl2 APN 9 54,322,759 (GRCm39) missense probably damaging 1.00
IGL01538:Dmxl2 APN 9 54,352,660 (GRCm39) splice site probably benign
IGL01645:Dmxl2 APN 9 54,286,017 (GRCm39) missense possibly damaging 0.93
IGL02096:Dmxl2 APN 9 54,308,349 (GRCm39) missense possibly damaging 0.89
IGL02104:Dmxl2 APN 9 54,311,299 (GRCm39) nonsense probably null
IGL02145:Dmxl2 APN 9 54,281,981 (GRCm39) missense probably benign 0.29
IGL02210:Dmxl2 APN 9 54,311,333 (GRCm39) missense probably damaging 1.00
IGL02238:Dmxl2 APN 9 54,352,717 (GRCm39) missense probably damaging 1.00
IGL02255:Dmxl2 APN 9 54,301,052 (GRCm39) missense probably benign 0.06
IGL02364:Dmxl2 APN 9 54,301,127 (GRCm39) missense probably benign 0.02
IGL02423:Dmxl2 APN 9 54,301,032 (GRCm39) missense possibly damaging 0.89
IGL02440:Dmxl2 APN 9 54,313,899 (GRCm39) missense probably damaging 0.98
IGL02546:Dmxl2 APN 9 54,273,698 (GRCm39) utr 3 prime probably benign
IGL02668:Dmxl2 APN 9 54,324,229 (GRCm39) missense probably damaging 1.00
IGL03229:Dmxl2 APN 9 54,311,456 (GRCm39) missense probably damaging 1.00
IGL03244:Dmxl2 APN 9 54,323,655 (GRCm39) missense probably damaging 1.00
IGL03277:Dmxl2 APN 9 54,311,504 (GRCm39) missense probably damaging 1.00
IGL03399:Dmxl2 APN 9 54,353,956 (GRCm39) missense probably damaging 1.00
BB003:Dmxl2 UTSW 9 54,335,326 (GRCm39) missense probably benign 0.01
BB013:Dmxl2 UTSW 9 54,335,326 (GRCm39) missense probably benign 0.01
I2288:Dmxl2 UTSW 9 54,309,077 (GRCm39) missense probably damaging 1.00
P0014:Dmxl2 UTSW 9 54,309,048 (GRCm39) missense probably damaging 1.00
R0411:Dmxl2 UTSW 9 54,286,223 (GRCm39) missense probably damaging 1.00
R0422:Dmxl2 UTSW 9 54,307,224 (GRCm39) critical splice donor site probably null
R0432:Dmxl2 UTSW 9 54,324,235 (GRCm39) missense probably benign 0.01
R0436:Dmxl2 UTSW 9 54,291,034 (GRCm39) missense probably damaging 1.00
R0538:Dmxl2 UTSW 9 54,301,120 (GRCm39) missense probably benign 0.06
R0603:Dmxl2 UTSW 9 54,313,190 (GRCm39) missense possibly damaging 0.95
R0605:Dmxl2 UTSW 9 54,327,229 (GRCm39) missense probably benign 0.01
R0625:Dmxl2 UTSW 9 54,289,986 (GRCm39) missense probably benign
R0626:Dmxl2 UTSW 9 54,323,838 (GRCm39) missense probably damaging 1.00
R0736:Dmxl2 UTSW 9 54,286,101 (GRCm39) missense probably damaging 0.99
R0847:Dmxl2 UTSW 9 54,313,112 (GRCm39) missense probably damaging 1.00
R0855:Dmxl2 UTSW 9 54,273,724 (GRCm39) missense probably benign 0.03
R0962:Dmxl2 UTSW 9 54,353,696 (GRCm39) missense probably damaging 0.99
R1015:Dmxl2 UTSW 9 54,275,049 (GRCm39) missense probably benign 0.32
R1084:Dmxl2 UTSW 9 54,323,717 (GRCm39) missense probably damaging 1.00
R1328:Dmxl2 UTSW 9 54,303,533 (GRCm39) missense probably benign 0.12
R1401:Dmxl2 UTSW 9 54,322,712 (GRCm39) critical splice donor site probably null
R1503:Dmxl2 UTSW 9 54,354,272 (GRCm39) nonsense probably null
R1609:Dmxl2 UTSW 9 54,316,547 (GRCm39) missense possibly damaging 0.90
R1613:Dmxl2 UTSW 9 54,289,311 (GRCm39) missense probably benign
R1660:Dmxl2 UTSW 9 54,358,314 (GRCm39) missense possibly damaging 0.68
R1712:Dmxl2 UTSW 9 54,308,769 (GRCm39) missense probably benign 0.00
R1772:Dmxl2 UTSW 9 54,330,508 (GRCm39) splice site probably benign
R1832:Dmxl2 UTSW 9 54,368,233 (GRCm39) missense probably damaging 0.97
R1922:Dmxl2 UTSW 9 54,308,807 (GRCm39) missense probably benign
R2104:Dmxl2 UTSW 9 54,322,848 (GRCm39) missense probably damaging 1.00
R2109:Dmxl2 UTSW 9 54,301,097 (GRCm39) missense probably benign 0.06
R2145:Dmxl2 UTSW 9 54,323,194 (GRCm39) missense probably damaging 1.00
R2199:Dmxl2 UTSW 9 54,283,527 (GRCm39) missense probably benign 0.35
R2352:Dmxl2 UTSW 9 54,301,146 (GRCm39) missense probably damaging 1.00
R2516:Dmxl2 UTSW 9 54,307,378 (GRCm39) missense probably damaging 1.00
R2981:Dmxl2 UTSW 9 54,300,986 (GRCm39) missense probably damaging 1.00
R3430:Dmxl2 UTSW 9 54,384,745 (GRCm39) missense possibly damaging 0.94
R3625:Dmxl2 UTSW 9 54,300,927 (GRCm39) missense probably benign 0.23
R3725:Dmxl2 UTSW 9 54,301,053 (GRCm39) missense probably damaging 1.00
R3787:Dmxl2 UTSW 9 54,277,162 (GRCm39) missense probably damaging 1.00
R4002:Dmxl2 UTSW 9 54,381,116 (GRCm39) splice site probably benign
R4004:Dmxl2 UTSW 9 54,353,674 (GRCm39) missense probably benign 0.04
R4005:Dmxl2 UTSW 9 54,353,674 (GRCm39) missense probably benign 0.04
R4012:Dmxl2 UTSW 9 54,286,297 (GRCm39) splice site probably null
R4014:Dmxl2 UTSW 9 54,285,993 (GRCm39) splice site probably null
R4115:Dmxl2 UTSW 9 54,354,272 (GRCm39) nonsense probably null
R4232:Dmxl2 UTSW 9 54,327,193 (GRCm39) missense possibly damaging 0.89
R4388:Dmxl2 UTSW 9 54,303,551 (GRCm39) missense probably damaging 1.00
R4513:Dmxl2 UTSW 9 54,327,168 (GRCm39) missense probably null 0.17
R4552:Dmxl2 UTSW 9 54,359,047 (GRCm39) missense probably damaging 1.00
R4609:Dmxl2 UTSW 9 54,353,796 (GRCm39) missense probably damaging 1.00
R4625:Dmxl2 UTSW 9 54,311,404 (GRCm39) missense possibly damaging 0.55
R4694:Dmxl2 UTSW 9 54,354,189 (GRCm39) missense probably benign 0.04
R4711:Dmxl2 UTSW 9 54,358,208 (GRCm39) missense probably benign 0.37
R4715:Dmxl2 UTSW 9 54,353,689 (GRCm39) splice site probably null
R4746:Dmxl2 UTSW 9 54,359,080 (GRCm39) missense probably benign 0.04
R4789:Dmxl2 UTSW 9 54,287,099 (GRCm39) missense probably benign 0.30
R4825:Dmxl2 UTSW 9 54,311,325 (GRCm39) missense probably benign 0.01
R4911:Dmxl2 UTSW 9 54,318,937 (GRCm39) missense probably damaging 1.00
R4995:Dmxl2 UTSW 9 54,408,725 (GRCm39) utr 5 prime probably benign
R5026:Dmxl2 UTSW 9 54,323,960 (GRCm39) missense probably damaging 1.00
R5118:Dmxl2 UTSW 9 54,368,271 (GRCm39) missense probably damaging 1.00
R5174:Dmxl2 UTSW 9 54,352,768 (GRCm39) splice site probably null
R5288:Dmxl2 UTSW 9 54,286,041 (GRCm39) missense probably benign
R5373:Dmxl2 UTSW 9 54,276,473 (GRCm39) intron probably benign
R5374:Dmxl2 UTSW 9 54,276,473 (GRCm39) intron probably benign
R5385:Dmxl2 UTSW 9 54,286,041 (GRCm39) missense probably benign
R5386:Dmxl2 UTSW 9 54,286,041 (GRCm39) missense probably benign
R5418:Dmxl2 UTSW 9 54,281,935 (GRCm39) critical splice donor site probably null
R5540:Dmxl2 UTSW 9 54,301,141 (GRCm39) missense probably benign 0.21
R5568:Dmxl2 UTSW 9 54,330,643 (GRCm39) splice site probably null
R5733:Dmxl2 UTSW 9 54,283,550 (GRCm39) missense possibly damaging 0.64
R5758:Dmxl2 UTSW 9 54,380,248 (GRCm39) missense probably benign 0.28
R5759:Dmxl2 UTSW 9 54,282,792 (GRCm39) missense probably damaging 1.00
R5893:Dmxl2 UTSW 9 54,294,704 (GRCm39) missense possibly damaging 0.64
R6030:Dmxl2 UTSW 9 54,300,957 (GRCm39) missense probably benign 0.18
R6030:Dmxl2 UTSW 9 54,300,957 (GRCm39) missense probably benign 0.18
R6041:Dmxl2 UTSW 9 54,324,037 (GRCm39) missense probably damaging 1.00
R6174:Dmxl2 UTSW 9 54,301,011 (GRCm39) missense probably damaging 1.00
R6278:Dmxl2 UTSW 9 54,323,046 (GRCm39) missense probably damaging 1.00
R6307:Dmxl2 UTSW 9 54,289,990 (GRCm39) missense possibly damaging 0.68
R6349:Dmxl2 UTSW 9 54,327,193 (GRCm39) missense possibly damaging 0.89
R6404:Dmxl2 UTSW 9 54,282,820 (GRCm39) missense probably damaging 1.00
R6516:Dmxl2 UTSW 9 54,323,960 (GRCm39) missense probably damaging 1.00
R6712:Dmxl2 UTSW 9 54,318,908 (GRCm39) missense probably damaging 1.00
R6747:Dmxl2 UTSW 9 54,323,372 (GRCm39) missense probably damaging 1.00
R6769:Dmxl2 UTSW 9 54,323,808 (GRCm39) missense probably damaging 1.00
R6771:Dmxl2 UTSW 9 54,323,808 (GRCm39) missense probably damaging 1.00
R6800:Dmxl2 UTSW 9 54,316,467 (GRCm39) missense probably damaging 1.00
R6891:Dmxl2 UTSW 9 54,387,664 (GRCm39) missense probably damaging 0.99
R6920:Dmxl2 UTSW 9 54,379,496 (GRCm39) missense probably damaging 1.00
R6979:Dmxl2 UTSW 9 54,358,163 (GRCm39) missense possibly damaging 0.49
R7147:Dmxl2 UTSW 9 54,324,013 (GRCm39) missense probably benign 0.06
R7327:Dmxl2 UTSW 9 54,308,869 (GRCm39) missense probably damaging 1.00
R7462:Dmxl2 UTSW 9 54,273,916 (GRCm39) splice site probably null
R7526:Dmxl2 UTSW 9 54,308,241 (GRCm39) missense possibly damaging 0.47
R7569:Dmxl2 UTSW 9 54,323,271 (GRCm39) missense possibly damaging 0.51
R7638:Dmxl2 UTSW 9 54,365,078 (GRCm39) missense unknown
R7703:Dmxl2 UTSW 9 54,368,370 (GRCm39) missense probably benign 0.01
R7768:Dmxl2 UTSW 9 54,288,223 (GRCm39) missense probably damaging 1.00
R7926:Dmxl2 UTSW 9 54,335,326 (GRCm39) missense probably benign 0.01
R7969:Dmxl2 UTSW 9 54,354,165 (GRCm39) missense possibly damaging 0.85
R8007:Dmxl2 UTSW 9 54,290,975 (GRCm39) nonsense probably null
R8200:Dmxl2 UTSW 9 54,387,630 (GRCm39) missense probably benign
R8311:Dmxl2 UTSW 9 54,354,217 (GRCm39) missense probably benign 0.00
R8320:Dmxl2 UTSW 9 54,291,043 (GRCm39) missense probably benign
R8377:Dmxl2 UTSW 9 54,286,032 (GRCm39) missense probably damaging 1.00
R8400:Dmxl2 UTSW 9 54,291,037 (GRCm39) missense probably benign 0.03
R8509:Dmxl2 UTSW 9 54,335,341 (GRCm39) nonsense probably null
R8698:Dmxl2 UTSW 9 54,281,953 (GRCm39) missense probably benign 0.10
R8768:Dmxl2 UTSW 9 54,301,105 (GRCm39) missense possibly damaging 0.83
R8770:Dmxl2 UTSW 9 54,311,298 (GRCm39) missense probably benign 0.01
R8799:Dmxl2 UTSW 9 54,327,027 (GRCm39) critical splice donor site probably null
R8840:Dmxl2 UTSW 9 54,309,139 (GRCm39) missense possibly damaging 0.58
R8898:Dmxl2 UTSW 9 54,308,941 (GRCm39) missense probably benign 0.01
R8954:Dmxl2 UTSW 9 54,381,156 (GRCm39) missense probably benign 0.04
R9083:Dmxl2 UTSW 9 54,316,548 (GRCm39) missense probably benign 0.29
R9114:Dmxl2 UTSW 9 54,307,321 (GRCm39) missense
R9115:Dmxl2 UTSW 9 54,309,011 (GRCm39) missense probably benign
R9263:Dmxl2 UTSW 9 54,358,945 (GRCm39) missense probably benign 0.01
R9272:Dmxl2 UTSW 9 54,311,404 (GRCm39) missense possibly damaging 0.55
R9577:Dmxl2 UTSW 9 54,323,664 (GRCm39) missense unknown
R9673:Dmxl2 UTSW 9 54,294,840 (GRCm39) missense probably damaging 1.00
R9722:Dmxl2 UTSW 9 54,323,892 (GRCm39) missense probably benign 0.00
R9726:Dmxl2 UTSW 9 54,322,996 (GRCm39) missense probably benign 0.09
R9797:Dmxl2 UTSW 9 54,358,187 (GRCm39) missense probably benign 0.00
X0064:Dmxl2 UTSW 9 54,308,997 (GRCm39) missense probably benign
Z1177:Dmxl2 UTSW 9 54,289,318 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAGATCTTTTAGAAACATTTCCCC -3'
(R):5'- CGGTGAGACTCAGCTTGTAATG -3'

Sequencing Primer
(F):5'- TGAGAACTAAGCTCAGGACTTC -3'
(R):5'- ATGGATGTAGCAATATCATGTATGGG -3'
Posted On 2019-10-24