Incidental Mutation 'R7622:Zc3h12d'
ID589204
Institutional Source Beutler Lab
Gene Symbol Zc3h12d
Ensembl Gene ENSMUSG00000039981
Gene Namezinc finger CCCH type containing 12D
SynonymsD730019B10Rik, TFL
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R7622 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location7832470-7870396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7867269 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 268 (K268E)
Ref Sequence ENSEMBL: ENSMUSP00000040217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039484]
Predicted Effect probably damaging
Transcript: ENSMUST00000039484
AA Change: K268E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040217
Gene: ENSMUSG00000039981
AA Change: K268E

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 91 247 4e-67 PFAM
low complexity region 333 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit disrupted regulation of excessive inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,948,413 C1502* probably null Het
Adgrd1 G A 5: 129,139,624 D384N probably benign Het
Aqp8 T C 7: 123,466,660 F226S possibly damaging Het
Arl6ip6 A G 2: 53,217,327 Y207C probably damaging Het
Cbfa2t2 A G 2: 154,500,445 E27G possibly damaging Het
Cdc42bpb T G 12: 111,294,772 E201A unknown Het
Cfap54 A C 10: 92,956,944 V1769G unknown Het
Dmxl2 C T 9: 54,472,218 G7S probably damaging Het
Dnah6 G T 6: 73,124,759 F1927L possibly damaging Het
Dnajc6 A G 4: 101,640,491 E942G probably damaging Het
Fam170a A G 18: 50,282,902 R324G probably benign Het
Gapdhs G A 7: 30,739,331 T9I unknown Het
Gm10320 T A 13: 98,489,724 R51* probably null Het
Gm19410 A T 8: 35,810,347 T1776S possibly damaging Het
Gm4846 A T 1: 166,495,872 M94K possibly damaging Het
Ighv2-5 G A 12: 113,685,738 Q32* probably null Het
Klc2 T C 19: 5,111,632 E310G probably damaging Het
Krt75 A G 15: 101,570,272 M309T probably damaging Het
Lrp11 G A 10: 7,590,172 G41R unknown Het
Lrrc52 G T 1: 167,466,095 P207Q probably benign Het
Lrrc52 G T 1: 167,466,096 P207T probably benign Het
Lrrk2 A T 15: 91,812,323 D2438V probably damaging Het
Mycbp C T 4: 123,905,301 T28M probably damaging Het
Myh14 A G 7: 44,632,422 V804A probably benign Het
Myo16 A G 8: 10,376,238 I332V unknown Het
Ncor1 G T 11: 62,317,968 Q1359K probably benign Het
Olfr1055 A G 2: 86,347,662 Y35H possibly damaging Het
Olfr1112 A T 2: 87,192,250 I188L probably benign Het
Olfr50 A G 2: 36,793,931 K232E probably benign Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Oog3 T C 4: 144,158,319 D349G probably benign Het
Pate4 A G 9: 35,608,299 S32P possibly damaging Het
Pcdhb7 A C 18: 37,342,461 S217R probably benign Het
Pde1c G A 6: 56,126,925 R580C probably damaging Het
Pi4ka C A 16: 17,293,977 A1545S Het
Pign G T 1: 105,648,117 T266K possibly damaging Het
Pitpnm2 A G 5: 124,122,027 I1134T probably benign Het
Ppfia2 G A 10: 106,830,659 V409I possibly damaging Het
Prr7 A G 13: 55,472,796 T206A probably benign Het
Rnf13 A T 3: 57,820,534 R212* probably null Het
Rwdd2b T C 16: 87,434,612 N218S probably benign Het
Serpina3m A G 12: 104,389,575 D167G possibly damaging Het
Slit2 A T 5: 47,985,205 N56Y probably damaging Het
Sprr3 G T 3: 92,457,285 T84K probably damaging Het
Stab2 A T 10: 86,873,902 H1626Q possibly damaging Het
Tex2 C A 11: 106,546,895 D650Y unknown Het
Tmprss6 A G 15: 78,446,726 S436P probably benign Het
Uba2 A C 7: 34,165,435 F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 S242L probably damaging Het
Vmn1r86 T G 7: 13,102,758 I64L probably benign Het
Vmn2r67 A T 7: 85,136,454 V781E probably damaging Het
Vmn2r80 T A 10: 79,194,263 F641Y probably damaging Het
Wdfy4 A T 14: 33,078,274 I1965K Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Wdr90 G T 17: 25,854,109 F837L probably benign Het
Xpo4 A G 14: 57,597,011 V704A possibly damaging Het
Other mutations in Zc3h12d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Zc3h12d APN 10 7862467 missense probably damaging 1.00
IGL01013:Zc3h12d APN 10 7839956 missense probably damaging 1.00
IGL02090:Zc3h12d APN 10 7867332 missense probably benign 0.00
IGL02876:Zc3h12d APN 10 7862600 missense probably damaging 0.99
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R1942:Zc3h12d UTSW 10 7853313 missense probably damaging 1.00
R2290:Zc3h12d UTSW 10 7867459 missense probably benign 0.00
R2354:Zc3h12d UTSW 10 7867938 missense probably benign 0.00
R4816:Zc3h12d UTSW 10 7867947 missense probably damaging 1.00
R4932:Zc3h12d UTSW 10 7853250 missense probably damaging 0.99
R5191:Zc3h12d UTSW 10 7867818 missense possibly damaging 0.51
R5384:Zc3h12d UTSW 10 7853250 missense probably damaging 1.00
R5396:Zc3h12d UTSW 10 7866326 missense probably damaging 1.00
R6409:Zc3h12d UTSW 10 7867318 missense probably benign 0.04
R6877:Zc3h12d UTSW 10 7839971 missense probably damaging 0.99
R6903:Zc3h12d UTSW 10 7867661 missense probably benign
R6967:Zc3h12d UTSW 10 7839880 missense probably damaging 1.00
R7312:Zc3h12d UTSW 10 7867581 missense probably benign 0.00
R7594:Zc3h12d UTSW 10 7862618 missense probably damaging 1.00
R7645:Zc3h12d UTSW 10 7867576 missense probably benign
R7769:Zc3h12d UTSW 10 7867626 missense probably benign 0.03
R7864:Zc3h12d UTSW 10 7839959 missense possibly damaging 0.83
R7947:Zc3h12d UTSW 10 7839959 missense possibly damaging 0.83
Z1177:Zc3h12d UTSW 10 7867808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTACTTACTCAGCTGACCTTG -3'
(R):5'- ATTCAAAGCTGCCAGGACC -3'

Sequencing Primer
(F):5'- CCTTGGGGGTTACAGAGCTC -3'
(R):5'- GGCTCCTGGGGAAGCAG -3'
Posted On2019-10-24