Mutagenetix > Incidental Mutation

Incidental Mutation 'R7622:Vmn2r80'

589205

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r80

Ensembl Gene

ENSMUSG00000091888

Gene Name

vomeronasal 2, receptor 80

Synonyms

EG624765

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R7622 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79148797-79195012 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79194263 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 641 (F641Y)

Ref Sequence

ENSEMBL: ENSMUSP00000132299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165834]

AlphaFold

E9Q1L0

Predicted Effect

probably damaging
Transcript: ENSMUST00000165834
AA Change: F641Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132299
Gene: ENSMUSG00000091888
AA Change: F641Y

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	79	474	1.5e-36	PFAM
Pfam:NCD3G	517	570	7.9e-22	PFAM
Pfam:7tm_3	603	838	6.2e-49	PFAM

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (55/56)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,948,413	C1502*	probably null	Het
Adgrd1	G	A	5: 129,139,624	D384N	probably benign	Het
Aqp8	T	C	7: 123,466,660	F226S	possibly damaging	Het
Arl6ip6	A	G	2: 53,217,327	Y207C	probably damaging	Het
Cbfa2t2	A	G	2: 154,500,445	E27G	possibly damaging	Het
Cdc42bpb	T	G	12: 111,294,772	E201A	unknown	Het
Cfap54	A	C	10: 92,956,944	V1769G	unknown	Het
Dmxl2	C	T	9: 54,472,218	G7S	probably damaging	Het
Dnah6	G	T	6: 73,124,759	F1927L	possibly damaging	Het
Dnajc6	A	G	4: 101,640,491	E942G	probably damaging	Het
Fam170a	A	G	18: 50,282,902	R324G	probably benign	Het
Gapdhs	G	A	7: 30,739,331	T9I	unknown	Het
Gm10320	T	A	13: 98,489,724	R51*	probably null	Het
Gm19410	A	T	8: 35,810,347	T1776S	possibly damaging	Het
Gm4846	A	T	1: 166,495,872	M94K	possibly damaging	Het
Ighv2-5	G	A	12: 113,685,738	Q32*	probably null	Het
Klc2	T	C	19: 5,111,632	E310G	probably damaging	Het
Krt75	A	G	15: 101,570,272	M309T	probably damaging	Het
Lrp11	G	A	10: 7,590,172	G41R	unknown	Het
Lrrc52	G	T	1: 167,466,095	P207Q	probably benign	Het
Lrrc52	G	T	1: 167,466,096	P207T	probably benign	Het
Lrrk2	A	T	15: 91,812,323	D2438V	probably damaging	Het
Mycbp	C	T	4: 123,905,301	T28M	probably damaging	Het
Myh14	A	G	7: 44,632,422	V804A	probably benign	Het
Myo16	A	G	8: 10,376,238	I332V	unknown	Het
Ncor1	G	T	11: 62,317,968	Q1359K	probably benign	Het
Olfr1055	A	G	2: 86,347,662	Y35H	possibly damaging	Het
Olfr1112	A	T	2: 87,192,250	I188L	probably benign	Het
Olfr50	A	G	2: 36,793,931	K232E	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,623	H229R	probably benign	Het
Oog3	T	C	4: 144,158,319	D349G	probably benign	Het
Pate4	A	G	9: 35,608,299	S32P	possibly damaging	Het
Pcdhb7	A	C	18: 37,342,461	S217R	probably benign	Het
Pde1c	G	A	6: 56,126,925	R580C	probably damaging	Het
Pi4ka	C	A	16: 17,293,977	A1545S		Het
Pign	G	T	1: 105,648,117	T266K	possibly damaging	Het
Pitpnm2	A	G	5: 124,122,027	I1134T	probably benign	Het
Ppfia2	G	A	10: 106,830,659	V409I	possibly damaging	Het
Prr7	A	G	13: 55,472,796	T206A	probably benign	Het
Rnf13	A	T	3: 57,820,534	R212*	probably null	Het
Rwdd2b	T	C	16: 87,434,612	N218S	probably benign	Het
Serpina3m	A	G	12: 104,389,575	D167G	possibly damaging	Het
Slit2	A	T	5: 47,985,205	N56Y	probably damaging	Het
Sprr3	G	T	3: 92,457,285	T84K	probably damaging	Het
Stab2	A	T	10: 86,873,902	H1626Q	possibly damaging	Het
Tex2	C	A	11: 106,546,895	D650Y	unknown	Het
Tmprss6	A	G	15: 78,446,726	S436P	probably benign	Het
Uba2	A	C	7: 34,165,435	F63L	probably damaging	Het
Ubxn2b	C	T	4: 6,214,692	S242L	probably damaging	Het
Vmn1r86	T	G	7: 13,102,758	I64L	probably benign	Het
Vmn2r67	A	T	7: 85,136,454	V781E	probably damaging	Het
Wdfy4	A	T	14: 33,078,274	I1965K		Het
Wdr25	G	A	12: 108,992,893	G344S	possibly damaging	Het
Wdr90	G	T	17: 25,854,109	F837L	probably benign	Het
Xpo4	A	G	14: 57,597,011	V704A	possibly damaging	Het
Zc3h12d	A	G	10: 7,867,269	K268E	probably damaging	Het

Other mutations in Vmn2r80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Vmn2r80	APN	10	79194599	missense	probably damaging	1.00
IGL01325:Vmn2r80	APN	10	79194247	missense	possibly damaging	0.62
IGL01611:Vmn2r80	APN	10	79171654	missense	probably damaging	1.00
IGL01799:Vmn2r80	APN	10	79171551	missense	possibly damaging	0.95
IGL01877:Vmn2r80	APN	10	79171500	splice site	probably null
IGL02673:Vmn2r80	APN	10	79169484	missense	probably benign	0.02
IGL02756:Vmn2r80	APN	10	79194311	missense	probably damaging	1.00
IGL02820:Vmn2r80	APN	10	79171605	missense	probably benign	0.04
IGL03382:Vmn2r80	APN	10	79169528	missense	probably damaging	1.00
R0071:Vmn2r80	UTSW	10	79171732	missense	possibly damaging	0.83
R0071:Vmn2r80	UTSW	10	79171732	missense	possibly damaging	0.83
R0129:Vmn2r80	UTSW	10	79169496	missense	probably damaging	1.00
R0325:Vmn2r80	UTSW	10	79148939	missense	possibly damaging	0.89
R0567:Vmn2r80	UTSW	10	79194831	missense	possibly damaging	0.89
R1510:Vmn2r80	UTSW	10	79169719	missense	possibly damaging	0.69
R1519:Vmn2r80	UTSW	10	79194219	missense	probably damaging	1.00
R1520:Vmn2r80	UTSW	10	79194760	missense	probably damaging	1.00
R1627:Vmn2r80	UTSW	10	79194415	missense	probably damaging	1.00
R1709:Vmn2r80	UTSW	10	79194389	missense	probably benign	0.04
R2116:Vmn2r80	UTSW	10	79194724	missense	probably benign	0.09
R2237:Vmn2r80	UTSW	10	79168270	missense	probably damaging	1.00
R2308:Vmn2r80	UTSW	10	79171621	missense	probably damaging	1.00
R2893:Vmn2r80	UTSW	10	79148865	missense	possibly damaging	0.63
R3408:Vmn2r80	UTSW	10	79168393	missense	possibly damaging	0.95
R4502:Vmn2r80	UTSW	10	79148930	missense	probably benign	0.00
R4685:Vmn2r80	UTSW	10	79194328	missense	possibly damaging	0.95
R4851:Vmn2r80	UTSW	10	79194322	missense	possibly damaging	0.68
R4947:Vmn2r80	UTSW	10	79194698	missense	probably damaging	1.00
R5112:Vmn2r80	UTSW	10	79194458	missense	possibly damaging	0.61
R5217:Vmn2r80	UTSW	10	79169146	missense	possibly damaging	0.62
R5226:Vmn2r80	UTSW	10	79194040	missense	probably benign	0.36
R5512:Vmn2r80	UTSW	10	79168232	missense	probably benign	0.00
R5618:Vmn2r80	UTSW	10	79148921	missense	probably benign
R5959:Vmn2r80	UTSW	10	79169479	missense	probably benign	0.00
R6104:Vmn2r80	UTSW	10	79149020	missense	probably benign	0.00
R6110:Vmn2r80	UTSW	10	79182003	missense	probably damaging	1.00
R6270:Vmn2r80	UTSW	10	79194325	missense	probably benign	0.00
R6508:Vmn2r80	UTSW	10	79194456	missense	probably benign	0.03
R6843:Vmn2r80	UTSW	10	79169668	missense	probably benign	0.08
R6894:Vmn2r80	UTSW	10	79169604	missense	probably benign	0.06
R7048:Vmn2r80	UTSW	10	79194319	missense	probably damaging	1.00
R7149:Vmn2r80	UTSW	10	79194820	missense	probably benign	0.00
R7262:Vmn2r80	UTSW	10	79169745	missense	probably damaging	0.98
R7559:Vmn2r80	UTSW	10	79194625	missense	probably benign	0.00
R8003:Vmn2r80	UTSW	10	79148877	missense	probably benign	0.16
R8207:Vmn2r80	UTSW	10	79194316	nonsense	probably null
R8330:Vmn2r80	UTSW	10	79171716	missense	probably damaging	1.00
R8337:Vmn2r80	UTSW	10	79148873	missense	probably benign	0.00
R8354:Vmn2r80	UTSW	10	79148876	missense	probably benign
R8688:Vmn2r80	UTSW	10	79168235	missense	probably damaging	1.00
R8903:Vmn2r80	UTSW	10	79182094	missense	probably damaging	1.00
R9088:Vmn2r80	UTSW	10	79169544	missense	probably benign	0.05
R9125:Vmn2r80	UTSW	10	79148926	missense	probably benign	0.12
R9147:Vmn2r80	UTSW	10	79194853	missense	probably damaging	0.98
R9148:Vmn2r80	UTSW	10	79194853	missense	probably damaging	0.98
R9187:Vmn2r80	UTSW	10	79194604	missense	probably benign	0.20
R9218:Vmn2r80	UTSW	10	79194436	missense	possibly damaging	0.61
R9553:Vmn2r80	UTSW	10	79148909	missense	probably benign
R9612:Vmn2r80	UTSW	10	79194878	missense	probably damaging	1.00
R9677:Vmn2r80	UTSW	10	79148838	missense	probably benign	0.15
R9769:Vmn2r80	UTSW	10	79169609	missense	probably damaging	1.00
Z1176:Vmn2r80	UTSW	10	79169477	missense	not run
Z1176:Vmn2r80	UTSW	10	79194398	missense	possibly damaging	0.65
Z1176:Vmn2r80	UTSW	10	79194607	missense	probably damaging	1.00
Z1176:Vmn2r80	UTSW	10	79194771	missense	probably damaging	1.00
Z1177:Vmn2r80	UTSW	10	79169477	missense	not run

Predicted Primers

PCR Primer
(F):5'- CAGAAACTCATTATGCGAATGGAG -3'
(R):5'- GGACCTGTGATGTCAGCAAC -3'

Sequencing Primer
(F):5'- GCCTGAAGAAAAGAGTAACATTTCTG -3'
(R):5'- GTGATGTCAGCAACCATCTTATC -3'

Posted On

2019-10-24