Mutagenetix > Incidental Mutation

Incidental Mutation 'R7622:Ppfia2'

589208

Institutional Source

Beutler Lab

Gene Symbol

Ppfia2

Ensembl Gene

ENSMUSG00000053825

Gene Name

protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2

Synonyms

Liprin-alpha2, E130120L08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7622 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106470339-106935952 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 106830659 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 409 (V409I)

Ref Sequence

ENSEMBL: ENSMUSP00000151545 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029404] [ENSMUST00000217854]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000029404
AA Change: V409I

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000029404
Gene: ENSMUSG00000053825
AA Change: V409I

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
coiled coil region	32	80	N/A	INTRINSIC
coiled coil region	102	150	N/A	INTRINSIC
coiled coil region	189	234	N/A	INTRINSIC
coiled coil region	267	541	N/A	INTRINSIC
low complexity region	576	587	N/A	INTRINSIC
low complexity region	616	631	N/A	INTRINSIC
coiled coil region	643	691	N/A	INTRINSIC
low complexity region	702	725	N/A	INTRINSIC
SAM	895	964	6.27e-10	SMART
low complexity region	965	977	N/A	INTRINSIC
SAM	1017	1084	1.69e-6	SMART
SAM	1105	1177	6.62e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217854
AA Change: V409I

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.1178

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein has been shown to bind the calcium/calmodulin-dependent serine protein kinase (MAGUK family) protein (also known as CASK) and proposed to regulate higher-order brain functions in mammals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,948,413	C1502*	probably null	Het
Adgrd1	G	A	5: 129,139,624	D384N	probably benign	Het
Aqp8	T	C	7: 123,466,660	F226S	possibly damaging	Het
Arl6ip6	A	G	2: 53,217,327	Y207C	probably damaging	Het
Cbfa2t2	A	G	2: 154,500,445	E27G	possibly damaging	Het
Cdc42bpb	T	G	12: 111,294,772	E201A	unknown	Het
Cfap54	A	C	10: 92,956,944	V1769G	unknown	Het
Dmxl2	C	T	9: 54,472,218	G7S	probably damaging	Het
Dnah6	G	T	6: 73,124,759	F1927L	possibly damaging	Het
Dnajc6	A	G	4: 101,640,491	E942G	probably damaging	Het
Fam170a	A	G	18: 50,282,902	R324G	probably benign	Het
Gapdhs	G	A	7: 30,739,331	T9I	unknown	Het
Gm10320	T	A	13: 98,489,724	R51*	probably null	Het
Gm19410	A	T	8: 35,810,347	T1776S	possibly damaging	Het
Gm4846	A	T	1: 166,495,872	M94K	possibly damaging	Het
Ighv2-5	G	A	12: 113,685,738	Q32*	probably null	Het
Klc2	T	C	19: 5,111,632	E310G	probably damaging	Het
Krt75	A	G	15: 101,570,272	M309T	probably damaging	Het
Lrp11	G	A	10: 7,590,172	G41R	unknown	Het
Lrrc52	G	T	1: 167,466,095	P207Q	probably benign	Het
Lrrc52	G	T	1: 167,466,096	P207T	probably benign	Het
Lrrk2	A	T	15: 91,812,323	D2438V	probably damaging	Het
Mycbp	C	T	4: 123,905,301	T28M	probably damaging	Het
Myh14	A	G	7: 44,632,422	V804A	probably benign	Het
Myo16	A	G	8: 10,376,238	I332V	unknown	Het
Ncor1	G	T	11: 62,317,968	Q1359K	probably benign	Het
Olfr1055	A	G	2: 86,347,662	Y35H	possibly damaging	Het
Olfr1112	A	T	2: 87,192,250	I188L	probably benign	Het
Olfr50	A	G	2: 36,793,931	K232E	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,623	H229R	probably benign	Het
Oog3	T	C	4: 144,158,319	D349G	probably benign	Het
Pate4	A	G	9: 35,608,299	S32P	possibly damaging	Het
Pcdhb7	A	C	18: 37,342,461	S217R	probably benign	Het
Pde1c	G	A	6: 56,126,925	R580C	probably damaging	Het
Pi4ka	C	A	16: 17,293,977	A1545S		Het
Pign	G	T	1: 105,648,117	T266K	possibly damaging	Het
Pitpnm2	A	G	5: 124,122,027	I1134T	probably benign	Het
Prr7	A	G	13: 55,472,796	T206A	probably benign	Het
Rnf13	A	T	3: 57,820,534	R212*	probably null	Het
Rwdd2b	T	C	16: 87,434,612	N218S	probably benign	Het
Serpina3m	A	G	12: 104,389,575	D167G	possibly damaging	Het
Slit2	A	T	5: 47,985,205	N56Y	probably damaging	Het
Sprr3	G	T	3: 92,457,285	T84K	probably damaging	Het
Stab2	A	T	10: 86,873,902	H1626Q	possibly damaging	Het
Tex2	C	A	11: 106,546,895	D650Y	unknown	Het
Tmprss6	A	G	15: 78,446,726	S436P	probably benign	Het
Uba2	A	C	7: 34,165,435	F63L	probably damaging	Het
Ubxn2b	C	T	4: 6,214,692	S242L	probably damaging	Het
Vmn1r86	T	G	7: 13,102,758	I64L	probably benign	Het
Vmn2r67	A	T	7: 85,136,454	V781E	probably damaging	Het
Vmn2r80	T	A	10: 79,194,263	F641Y	probably damaging	Het
Wdfy4	A	T	14: 33,078,274	I1965K		Het
Wdr25	G	A	12: 108,992,893	G344S	possibly damaging	Het
Wdr90	G	T	17: 25,854,109	F837L	probably benign	Het
Xpo4	A	G	14: 57,597,011	V704A	possibly damaging	Het
Zc3h12d	A	G	10: 7,867,269	K268E	probably damaging	Het

Other mutations in Ppfia2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Ppfia2	APN	10	106819492	missense	probably benign	0.25
IGL01296:Ppfia2	APN	10	106858207	missense	probably damaging	0.98
IGL01385:Ppfia2	APN	10	106913699	missense	probably damaging	1.00
IGL01592:Ppfia2	APN	10	106836048	splice site	probably benign
IGL01899:Ppfia2	APN	10	106915751	critical splice donor site	probably null
IGL02063:Ppfia2	APN	10	106904845	missense	probably null	0.83
IGL02143:Ppfia2	APN	10	106857499	missense	probably damaging	1.00
IGL02170:Ppfia2	APN	10	106800785	missense	probably benign
IGL02565:Ppfia2	APN	10	106863386	critical splice donor site	probably null
IGL02573:Ppfia2	APN	10	106828928	missense	probably damaging	1.00
IGL02819:Ppfia2	APN	10	106906394	missense	probably damaging	1.00
IGL02974:Ppfia2	APN	10	106800776	missense	probably benign	0.08
IGL03165:Ppfia2	APN	10	106767487	missense	probably damaging	1.00
IGL03255:Ppfia2	APN	10	106896507	missense	possibly damaging	0.76
Colorless	UTSW	10	106913594	missense	probably damaging	1.00
PIT4458001:Ppfia2	UTSW	10	106927847	missense	probably benign	0.24
R0018:Ppfia2	UTSW	10	106842786	splice site	probably benign
R0018:Ppfia2	UTSW	10	106842786	splice site	probably benign
R0323:Ppfia2	UTSW	10	106896420	missense	possibly damaging	0.84
R0391:Ppfia2	UTSW	10	106830714	splice site	probably benign
R0667:Ppfia2	UTSW	10	106913694	missense	probably damaging	0.97
R0782:Ppfia2	UTSW	10	106927731	missense	probably benign	0.32
R0905:Ppfia2	UTSW	10	106819511	missense	probably benign	0.43
R1401:Ppfia2	UTSW	10	106830657	missense	possibly damaging	0.94
R1672:Ppfia2	UTSW	10	106830568	missense	possibly damaging	0.53
R1723:Ppfia2	UTSW	10	106915672	splice site	probably null
R1780:Ppfia2	UTSW	10	106896507	missense	possibly damaging	0.76
R1847:Ppfia2	UTSW	10	106927710	missense	probably benign	0.16
R2015:Ppfia2	UTSW	10	106474677	missense	probably benign	0.01
R2051:Ppfia2	UTSW	10	106837299	missense	probably damaging	0.98
R2061:Ppfia2	UTSW	10	106837329	missense	possibly damaging	0.94
R2115:Ppfia2	UTSW	10	106762111	missense	probably damaging	1.00
R2310:Ppfia2	UTSW	10	106854980	missense	probably damaging	0.99
R2394:Ppfia2	UTSW	10	106819490	missense	probably damaging	0.99
R2656:Ppfia2	UTSW	10	106865407	splice site	probably null
R3113:Ppfia2	UTSW	10	106906395	nonsense	probably null
R3968:Ppfia2	UTSW	10	106906521	missense	probably damaging	0.99
R3977:Ppfia2	UTSW	10	106830629	missense	possibly damaging	0.69
R3978:Ppfia2	UTSW	10	106830629	missense	possibly damaging	0.69
R3979:Ppfia2	UTSW	10	106830629	missense	possibly damaging	0.69
R4567:Ppfia2	UTSW	10	106865406	splice site	probably null
R4632:Ppfia2	UTSW	10	106836044	splice site	probably null
R4718:Ppfia2	UTSW	10	106858285	missense	probably damaging	1.00
R4758:Ppfia2	UTSW	10	106762117	missense	probably damaging	1.00
R4770:Ppfia2	UTSW	10	106762117	missense	probably damaging	1.00
R4810:Ppfia2	UTSW	10	106915690	missense	probably benign	0.01
R4841:Ppfia2	UTSW	10	106854957	missense	probably benign	0.04
R4842:Ppfia2	UTSW	10	106854957	missense	probably benign	0.04
R4914:Ppfia2	UTSW	10	106762117	missense	probably damaging	1.00
R4916:Ppfia2	UTSW	10	106762117	missense	probably damaging	1.00
R4917:Ppfia2	UTSW	10	106762117	missense	probably damaging	1.00
R5014:Ppfia2	UTSW	10	106865363	nonsense	probably null
R5029:Ppfia2	UTSW	10	106857443	missense	probably benign	0.04
R5127:Ppfia2	UTSW	10	106835760	missense	probably damaging	0.99
R5357:Ppfia2	UTSW	10	106904847	critical splice donor site	probably null
R5420:Ppfia2	UTSW	10	106835701	missense	possibly damaging	0.88
R6030:Ppfia2	UTSW	10	106906477	missense	probably damaging	1.00
R6030:Ppfia2	UTSW	10	106906477	missense	probably damaging	1.00
R6135:Ppfia2	UTSW	10	106857569	missense	probably damaging	1.00
R6237:Ppfia2	UTSW	10	106913594	missense	probably damaging	1.00
R6433:Ppfia2	UTSW	10	106913698	missense	possibly damaging	0.94
R6457:Ppfia2	UTSW	10	106893500	missense	probably damaging	1.00
R6542:Ppfia2	UTSW	10	106835725	missense	probably damaging	0.99
R6674:Ppfia2	UTSW	10	106927772	missense	probably benign	0.23
R6746:Ppfia2	UTSW	10	106906458	nonsense	probably null
R6992:Ppfia2	UTSW	10	106474854	missense	possibly damaging	0.88
R7060:Ppfia2	UTSW	10	106762109	missense	probably damaging	1.00
R7346:Ppfia2	UTSW	10	106857495	missense	possibly damaging	0.79
R7453:Ppfia2	UTSW	10	106927830	missense	possibly damaging	0.82
R7555:Ppfia2	UTSW	10	106927826	missense	probably benign	0.00
R7637:Ppfia2	UTSW	10	106865403	critical splice donor site	probably null
R7866:Ppfia2	UTSW	10	106819529	missense	probably damaging	0.97
R7897:Ppfia2	UTSW	10	106819538	missense	probably damaging	0.99
R7937:Ppfia2	UTSW	10	106863372	missense	probably benign	0.30
R7938:Ppfia2	UTSW	10	106474787	missense	probably damaging	0.97
R8218:Ppfia2	UTSW	10	106863375	missense	probably benign	0.07
R8431:Ppfia2	UTSW	10	106836091	nonsense	probably null
R8806:Ppfia2	UTSW	10	106858253	missense	probably damaging	1.00
R8984:Ppfia2	UTSW	10	106858578	intron	probably benign
R9008:Ppfia2	UTSW	10	106819359	missense	probably benign	0.00
R9014:Ppfia2	UTSW	10	106927805	missense	probably benign	0.05
R9182:Ppfia2	UTSW	10	106927779	missense	probably benign	0.39
R9201:Ppfia2	UTSW	10	106842779	critical splice donor site	probably null
R9249:Ppfia2	UTSW	10	106913568	missense	probably damaging	1.00
R9620:Ppfia2	UTSW	10	106913658	missense
R9710:Ppfia2	UTSW	10	106829024	missense	probably benign	0.00
X0021:Ppfia2	UTSW	10	106474677	missense	probably benign	0.06
X0022:Ppfia2	UTSW	10	106893434	missense	probably damaging	1.00
Z1176:Ppfia2	UTSW	10	106474645	missense	probably damaging	0.97
Z1177:Ppfia2	UTSW	10	106906555	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTACAGAGTTCATAGACTTGCTC -3'
(R):5'- AGGCAAGGATATCTTCTTACTCATG -3'

Sequencing Primer
(F):5'- AGAGTTCATAGACTTGCTCTAACTCC -3'
(R):5'- TCATGTAACAATCATTCAAGTCACAG -3'

Posted On

2019-10-24