Mutagenetix > Incidental Mutation

Incidental Mutation 'R7622:Ncor1'

589209

Institutional Source

Beutler Lab

Gene Symbol

Ncor1

Ensembl Gene

ENSMUSG00000018501

Gene Name

nuclear receptor co-repressor 1

Synonyms

5730405M06Rik, A230020K14Rik, Rxrip13, N-CoR

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7622 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62316426-62458541 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 62317968 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 1359 (Q1359K)

Ref Sequence

ENSEMBL: ENSMUSP00000038900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000037575] [ENSMUST00000050646] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000101075] [ENSMUST00000155712] [ENSMUST00000159315]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000018645
AA Change: Q2414K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: Q2414K

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
Pfam:GPS2_interact	150	239	1.4e-37	PFAM
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000037575
AA Change: Q1359K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000038900
Gene: ENSMUSG00000018501
AA Change: Q1359K

Domain	Start	End	E-Value	Type
low complexity region	28	41	N/A	INTRINSIC
low complexity region	461	472	N/A	INTRINSIC
coiled coil region	658	695	N/A	INTRINSIC
low complexity region	780	794	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
PDB:3N00\|B	1010	1030	2e-7	PDB
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
PDB:2OVM\|B	1212	1235	2e-8	PDB
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000050646

SMART Domains

Protein: ENSMUSP00000054367
Gene: ENSMUSG00000042298

Domain	Start	End	E-Value	Type
low complexity region	3	29	N/A	INTRINSIC
low complexity region	77	86	N/A	INTRINSIC
Blast:TPR	87	120	9e-6	BLAST
Blast:TPR	128	160	1e-9	BLAST
Pfam:TPR_12	216	301	1.1e-14	PFAM
Pfam:TPR_10	226	267	2.4e-6	PFAM
Pfam:TPR_10	307	339	5.4e-6	PFAM
Pfam:TPR_2	308	339	8.2e-5	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000101066
AA Change: Q2414K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: Q2414K

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101067
AA Change: Q2346K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: Q2346K

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	716	734	N/A	INTRINSIC
low complexity region	838	849	N/A	INTRINSIC
low complexity region	937	945	N/A	INTRINSIC
low complexity region	952	963	N/A	INTRINSIC
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1448	1459	N/A	INTRINSIC
coiled coil region	1645	1682	N/A	INTRINSIC
low complexity region	1767	1781	N/A	INTRINSIC
low complexity region	1902	1913	N/A	INTRINSIC
low complexity region	1969	1988	N/A	INTRINSIC
PDB:3N00\|B	1997	2017	4e-7	PDB
low complexity region	2019	2034	N/A	INTRINSIC
low complexity region	2089	2100	N/A	INTRINSIC
PDB:2OVM\|B	2199	2222	2e-8	PDB
low complexity region	2243	2256	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101075

SMART Domains

Protein: ENSMUSP00000098636
Gene: ENSMUSG00000042298

Domain	Start	End	E-Value	Type
low complexity region	3	29	N/A	INTRINSIC
low complexity region	77	86	N/A	INTRINSIC
Blast:TPR	87	120	9e-6	BLAST
Pfam:TPR_12	210	288	1.8e-14	PFAM
Pfam:TPR_10	213	254	3.4e-6	PFAM
Pfam:TPR_10	255	293	2e-3	PFAM
Pfam:TPR_10	294	327	3.7e-5	PFAM
Pfam:TPR_2	295	326	8e-5	PFAM
Pfam:TPR_1	296	326	8.7e-5	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155712
AA Change: Q1684K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501
AA Change: Q1684K

Domain	Start	End	E-Value	Type
low complexity region	26	47	N/A	INTRINSIC
low complexity region	87	104	N/A	INTRINSIC
low complexity region	204	215	N/A	INTRINSIC
low complexity region	303	311	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	352	365	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
coiled coil region	982	1019	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC
low complexity region	1239	1250	N/A	INTRINSIC
low complexity region	1306	1325	N/A	INTRINSIC
PDB:3N00\|B	1334	1354	3e-7	PDB
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1427	1438	N/A	INTRINSIC
PDB:2OVM\|B	1537	1560	2e-8	PDB
low complexity region	1581	1594	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000125458
Gene: ENSMUSG00000018501
AA Change: Q1348K

Domain	Start	End	E-Value	Type
low complexity region	18	31	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
coiled coil region	647	684	N/A	INTRINSIC
low complexity region	770	784	N/A	INTRINSIC
low complexity region	905	916	N/A	INTRINSIC
low complexity region	972	991	N/A	INTRINSIC
PDB:3N00\|B	1000	1020	2e-7	PDB
low complexity region	1022	1037	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
PDB:2OVM\|B	1202	1225	2e-8	PDB
low complexity region	1246	1259	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159315
AA Change: Q117K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000124175
Gene: ENSMUSG00000018501
AA Change: Q117K

Domain	Start	End	E-Value	Type
PDB:2OVM\|B	9	32	3e-9	PDB
low complexity region	53	66	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162385

SMART Domains

Protein: ENSMUSP00000125618
Gene: ENSMUSG00000042298

Domain	Start	End	E-Value	Type
Blast:TPR	8	40	4e-10	BLAST
Pfam:TPR_12	97	181	6.3e-15	PFAM
Pfam:TPR_10	106	147	2e-6	PFAM

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,948,413	C1502*	probably null	Het
Adgrd1	G	A	5: 129,139,624	D384N	probably benign	Het
Aqp8	T	C	7: 123,466,660	F226S	possibly damaging	Het
Arl6ip6	A	G	2: 53,217,327	Y207C	probably damaging	Het
Cbfa2t2	A	G	2: 154,500,445	E27G	possibly damaging	Het
Cdc42bpb	T	G	12: 111,294,772	E201A	unknown	Het
Cfap54	A	C	10: 92,956,944	V1769G	unknown	Het
Dmxl2	C	T	9: 54,472,218	G7S	probably damaging	Het
Dnah6	G	T	6: 73,124,759	F1927L	possibly damaging	Het
Dnajc6	A	G	4: 101,640,491	E942G	probably damaging	Het
Fam170a	A	G	18: 50,282,902	R324G	probably benign	Het
Gapdhs	G	A	7: 30,739,331	T9I	unknown	Het
Gm10320	T	A	13: 98,489,724	R51*	probably null	Het
Gm19410	A	T	8: 35,810,347	T1776S	possibly damaging	Het
Gm4846	A	T	1: 166,495,872	M94K	possibly damaging	Het
Ighv2-5	G	A	12: 113,685,738	Q32*	probably null	Het
Klc2	T	C	19: 5,111,632	E310G	probably damaging	Het
Krt75	A	G	15: 101,570,272	M309T	probably damaging	Het
Lrp11	G	A	10: 7,590,172	G41R	unknown	Het
Lrrc52	G	T	1: 167,466,095	P207Q	probably benign	Het
Lrrc52	G	T	1: 167,466,096	P207T	probably benign	Het
Lrrk2	A	T	15: 91,812,323	D2438V	probably damaging	Het
Mycbp	C	T	4: 123,905,301	T28M	probably damaging	Het
Myh14	A	G	7: 44,632,422	V804A	probably benign	Het
Myo16	A	G	8: 10,376,238	I332V	unknown	Het
Olfr1055	A	G	2: 86,347,662	Y35H	possibly damaging	Het
Olfr1112	A	T	2: 87,192,250	I188L	probably benign	Het
Olfr50	A	G	2: 36,793,931	K232E	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,623	H229R	probably benign	Het
Oog3	T	C	4: 144,158,319	D349G	probably benign	Het
Pate4	A	G	9: 35,608,299	S32P	possibly damaging	Het
Pcdhb7	A	C	18: 37,342,461	S217R	probably benign	Het
Pde1c	G	A	6: 56,126,925	R580C	probably damaging	Het
Pi4ka	C	A	16: 17,293,977	A1545S		Het
Pign	G	T	1: 105,648,117	T266K	possibly damaging	Het
Pitpnm2	A	G	5: 124,122,027	I1134T	probably benign	Het
Ppfia2	G	A	10: 106,830,659	V409I	possibly damaging	Het
Prr7	A	G	13: 55,472,796	T206A	probably benign	Het
Rnf13	A	T	3: 57,820,534	R212*	probably null	Het
Rwdd2b	T	C	16: 87,434,612	N218S	probably benign	Het
Serpina3m	A	G	12: 104,389,575	D167G	possibly damaging	Het
Slit2	A	T	5: 47,985,205	N56Y	probably damaging	Het
Sprr3	G	T	3: 92,457,285	T84K	probably damaging	Het
Stab2	A	T	10: 86,873,902	H1626Q	possibly damaging	Het
Tex2	C	A	11: 106,546,895	D650Y	unknown	Het
Tmprss6	A	G	15: 78,446,726	S436P	probably benign	Het
Uba2	A	C	7: 34,165,435	F63L	probably damaging	Het
Ubxn2b	C	T	4: 6,214,692	S242L	probably damaging	Het
Vmn1r86	T	G	7: 13,102,758	I64L	probably benign	Het
Vmn2r67	A	T	7: 85,136,454	V781E	probably damaging	Het
Vmn2r80	T	A	10: 79,194,263	F641Y	probably damaging	Het
Wdfy4	A	T	14: 33,078,274	I1965K		Het
Wdr25	G	A	12: 108,992,893	G344S	possibly damaging	Het
Wdr90	G	T	17: 25,854,109	F837L	probably benign	Het
Xpo4	A	G	14: 57,597,011	V704A	possibly damaging	Het
Zc3h12d	A	G	10: 7,867,269	K268E	probably damaging	Het

Other mutations in Ncor1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Ncor1	APN	11	62392528	missense	probably damaging	1.00
IGL01343:Ncor1	APN	11	62325486	critical splice donor site	probably null
IGL01392:Ncor1	APN	11	62340594	missense	probably damaging	0.99
IGL01402:Ncor1	APN	11	62340474	missense	probably damaging	1.00
IGL01714:Ncor1	APN	11	62334584	missense	possibly damaging	0.58
IGL01772:Ncor1	APN	11	62349347	intron	probably benign
IGL01889:Ncor1	APN	11	62334601	missense	possibly damaging	0.69
IGL02058:Ncor1	APN	11	62344637	missense	probably damaging	1.00
IGL02065:Ncor1	APN	11	62419609	missense	possibly damaging	0.95
IGL02073:Ncor1	APN	11	62358917	missense	probably damaging	0.99
IGL02176:Ncor1	APN	11	62329659	unclassified	probably benign
IGL02288:Ncor1	APN	11	62349403	missense	probably benign	0.01
IGL02348:Ncor1	APN	11	62333659	splice site	probably benign
IGL02608:Ncor1	APN	11	62373214	missense	probably benign	0.07
laggard	UTSW	11	62369304	missense	probably damaging	1.00
Shortstep	UTSW	11	62334541	missense	probably damaging	1.00
LCD18:Ncor1	UTSW	11	62419782	critical splice acceptor site	probably benign
PIT4382001:Ncor1	UTSW	11	62344663	missense	probably damaging	0.96
PIT4576001:Ncor1	UTSW	11	62333717	missense	probably damaging	0.99
R0026:Ncor1	UTSW	11	62438429	missense	probably damaging	1.00
R0038:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R0038:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R0103:Ncor1	UTSW	11	62343045	missense	possibly damaging	0.85
R0103:Ncor1	UTSW	11	62343045	missense	possibly damaging	0.85
R0144:Ncor1	UTSW	11	62392595	missense	probably damaging	1.00
R0427:Ncor1	UTSW	11	62410920	missense	probably damaging	1.00
R0501:Ncor1	UTSW	11	62373322	missense	possibly damaging	0.73
R0544:Ncor1	UTSW	11	62333776	missense	probably damaging	1.00
R0544:Ncor1	UTSW	11	62333777	missense	probably damaging	1.00
R0563:Ncor1	UTSW	11	62343230	missense	probably damaging	0.97
R1074:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R1266:Ncor1	UTSW	11	62334040	missense	probably damaging	0.98
R1444:Ncor1	UTSW	11	62403806	missense	probably damaging	1.00
R1452:Ncor1	UTSW	11	62334631	missense	probably damaging	1.00
R1534:Ncor1	UTSW	11	62378504	missense	possibly damaging	0.92
R1710:Ncor1	UTSW	11	62423005	missense	probably damaging	1.00
R1762:Ncor1	UTSW	11	62384784	missense	possibly damaging	0.82
R1771:Ncor1	UTSW	11	62327112	missense	probably damaging	1.00
R1864:Ncor1	UTSW	11	62381419	missense	probably damaging	1.00
R1902:Ncor1	UTSW	11	62338158	missense	probably damaging	1.00
R1906:Ncor1	UTSW	11	62349385	missense	possibly damaging	0.81
R2009:Ncor1	UTSW	11	62325601	missense	probably benign	0.43
R3708:Ncor1	UTSW	11	62344687	missense	probably damaging	1.00
R3825:Ncor1	UTSW	11	62373357	missense	probably benign	0.00
R3923:Ncor1	UTSW	11	62325616	missense	probably damaging	1.00
R3966:Ncor1	UTSW	11	62344757	missense	probably damaging	1.00
R4049:Ncor1	UTSW	11	62329668	splice site	probably null
R4350:Ncor1	UTSW	11	62410818	critical splice donor site	probably null
R4351:Ncor1	UTSW	11	62410818	critical splice donor site	probably null
R4359:Ncor1	UTSW	11	62358910	missense	probably damaging	1.00
R4712:Ncor1	UTSW	11	62344834	missense	probably damaging	1.00
R4723:Ncor1	UTSW	11	62378612	missense	probably benign	0.26
R4863:Ncor1	UTSW	11	62392638	missense	possibly damaging	0.92
R4875:Ncor1	UTSW	11	62433611	small deletion	probably benign
R4956:Ncor1	UTSW	11	62340605	missense	probably damaging	1.00
R4993:Ncor1	UTSW	11	62343341	missense	probably damaging	1.00
R5079:Ncor1	UTSW	11	62345237	missense	possibly damaging	0.92
R5144:Ncor1	UTSW	11	62349464	missense	probably damaging	1.00
R5223:Ncor1	UTSW	11	62339000	missense	probably damaging	1.00
R5243:Ncor1	UTSW	11	62338962	missense	probably damaging	1.00
R5271:Ncor1	UTSW	11	62340545	missense	probably damaging	1.00
R5285:Ncor1	UTSW	11	62392649	missense	probably damaging	1.00
R5533:Ncor1	UTSW	11	62343011	missense	probably benign	0.00
R5580:Ncor1	UTSW	11	62389778	nonsense	probably null
R5593:Ncor1	UTSW	11	62369304	missense	probably damaging	1.00
R5609:Ncor1	UTSW	11	62358853	splice site	probably null
R5632:Ncor1	UTSW	11	62338234	missense	possibly damaging	0.85
R5830:Ncor1	UTSW	11	62344763	missense	possibly damaging	0.71
R5896:Ncor1	UTSW	11	62383190	missense	probably damaging	1.00
R5973:Ncor1	UTSW	11	62349310	splice site	probably null
R6013:Ncor1	UTSW	11	62321077	missense	probably benign
R6019:Ncor1	UTSW	11	62373161	missense	probably benign	0.00
R6032:Ncor1	UTSW	11	62373321	missense	possibly damaging	0.54
R6032:Ncor1	UTSW	11	62373321	missense	possibly damaging	0.54
R6075:Ncor1	UTSW	11	62317849	missense	probably damaging	1.00
R6091:Ncor1	UTSW	11	62419617	missense	probably damaging	0.98
R6248:Ncor1	UTSW	11	62366982	missense	probably damaging	1.00
R6281:Ncor1	UTSW	11	62373545	missense	possibly damaging	0.71
R6351:Ncor1	UTSW	11	62373298	missense	probably benign	0.30
R6469:Ncor1	UTSW	11	62343302	missense	probably damaging	1.00
R6502:Ncor1	UTSW	11	62381414	nonsense	probably null
R6614:Ncor1	UTSW	11	62330819	missense	probably benign	0.01
R6650:Ncor1	UTSW	11	62334541	missense	probably damaging	1.00
R6765:Ncor1	UTSW	11	62373446	missense	probably benign	0.01
R6852:Ncor1	UTSW	11	62343245	missense	probably damaging	0.97
R6909:Ncor1	UTSW	11	62329486	missense	probably damaging	1.00
R6965:Ncor1	UTSW	11	62353233	critical splice donor site	probably null
R7054:Ncor1	UTSW	11	62384793	missense	probably null
R7248:Ncor1	UTSW	11	62384772	missense	possibly damaging	0.89
R7352:Ncor1	UTSW	11	62333911	missense	probably damaging	0.99
R7396:Ncor1	UTSW	11	62343218	missense	probably damaging	0.99
R7434:Ncor1	UTSW	11	62383199	missense	probably damaging	0.99
R7552:Ncor1	UTSW	11	62373424	missense	possibly damaging	0.53
R7565:Ncor1	UTSW	11	62401265	missense	probably damaging	1.00
R7575:Ncor1	UTSW	11	62383256	missense	probably benign	0.21
R7664:Ncor1	UTSW	11	62398328	missense	probably damaging	1.00
R7814:Ncor1	UTSW	11	62333926	missense	probably damaging	0.99
R7963:Ncor1	UTSW	11	62334533	missense	probably benign	0.28
R7990:Ncor1	UTSW	11	62349495	critical splice acceptor site	probably null
R8302:Ncor1	UTSW	11	62333855	missense	probably benign	0.00
R8334:Ncor1	UTSW	11	62383244	missense	probably damaging	0.99
R8512:Ncor1	UTSW	11	62433611	small deletion	probably benign
R8728:Ncor1	UTSW	11	62330859	missense	probably benign	0.04
R8777:Ncor1	UTSW	11	62433666	missense	probably benign	0.03
R8777:Ncor1	UTSW	11	62433668	missense	probably damaging	1.00
R8777-TAIL:Ncor1	UTSW	11	62433666	missense	probably benign	0.03
R8777-TAIL:Ncor1	UTSW	11	62433668	missense	probably damaging	1.00
R8821:Ncor1	UTSW	11	62369408	missense	probably benign	0.07
R8831:Ncor1	UTSW	11	62369408	missense	probably benign	0.07
R8988:Ncor1	UTSW	11	62343045	nonsense	probably null
R9111:Ncor1	UTSW	11	62389759	missense	possibly damaging	0.95
R9147:Ncor1	UTSW	11	62333846	missense	probably damaging	1.00
R9391:Ncor1	UTSW	11	62325550	nonsense	probably null
R9467:Ncor1	UTSW	11	62433611	small insertion	probably benign
R9467:Ncor1	UTSW	11	62433622	small insertion	probably benign
R9510:Ncor1	UTSW	11	62433616	small insertion	probably benign
R9511:Ncor1	UTSW	11	62433623	small insertion	probably benign
R9560:Ncor1	UTSW	11	62373122	missense	possibly damaging	0.96
R9687:Ncor1	UTSW	11	62369367	missense	possibly damaging	0.93
X0065:Ncor1	UTSW	11	62354569	critical splice donor site	probably null
X0065:Ncor1	UTSW	11	62358991	missense	probably benign	0.23
Z1176:Ncor1	UTSW	11	62438516	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCTCTCCTGAGAAGTCTCTG -3'
(R):5'- GGCATCAGCAGACCGTTTTAC -3'

Sequencing Primer
(F):5'- TCTCTGGGCACAAATCATGG -3'
(R):5'- GACCGTTTTACTAAAGCAGCATCCTG -3'

Posted On

2019-10-24