Incidental Mutation 'R7622:Wdr25'
ID 589212
Institutional Source Beutler Lab
Gene Symbol Wdr25
Ensembl Gene ENSMUSG00000040877
Gene Name WD repeat domain 25
Synonyms B930090D16Rik
MMRRC Submission 045717-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.932) question?
Stock # R7622 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 108860155-108994380 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 108958819 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 344 (G344S)
Ref Sequence ENSEMBL: ENSMUSP00000035553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047115] [ENSMUST00000167816] [ENSMUST00000220495]
AlphaFold E9Q349
Predicted Effect possibly damaging
Transcript: ENSMUST00000047115
AA Change: G344S

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035553
Gene: ENSMUSG00000040877
AA Change: G344S

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
WD40 226 268 1.83e-7 SMART
WD40 272 311 6.73e-6 SMART
WD40 312 353 2.58e-1 SMART
Blast:WD40 356 402 7e-11 BLAST
Blast:WD40 407 445 6e-8 BLAST
WD40 451 492 9.6e-2 SMART
WD40 495 535 3e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167816
AA Change: G344S

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129855
Gene: ENSMUSG00000040877
AA Change: G344S

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
WD40 226 268 1.83e-7 SMART
WD40 272 311 6.73e-6 SMART
WD40 312 353 2.58e-1 SMART
Blast:WD40 356 402 7e-11 BLAST
Blast:WD40 407 445 6e-8 BLAST
WD40 451 492 9.6e-2 SMART
WD40 495 535 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220495
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 G A 5: 129,216,688 (GRCm39) D384N probably benign Het
Aqp8 T C 7: 123,065,883 (GRCm39) F226S possibly damaging Het
Arl6ip6 A G 2: 53,107,339 (GRCm39) Y207C probably damaging Het
Bltp1 C A 3: 37,002,562 (GRCm39) C1502* probably null Het
Cbfa2t2 A G 2: 154,342,365 (GRCm39) E27G possibly damaging Het
Cdc42bpb T G 12: 111,261,206 (GRCm39) E201A unknown Het
Cfap54 A C 10: 92,792,806 (GRCm39) V1769G unknown Het
Dmxl2 C T 9: 54,379,502 (GRCm39) G7S probably damaging Het
Dnah6 G T 6: 73,101,742 (GRCm39) F1927L possibly damaging Het
Dnajc6 A G 4: 101,497,688 (GRCm39) E942G probably damaging Het
Fam170a A G 18: 50,415,969 (GRCm39) R324G probably benign Het
Gapdhs G A 7: 30,438,756 (GRCm39) T9I unknown Het
Gm10320 T A 13: 98,626,232 (GRCm39) R51* probably null Het
Gm19410 A T 8: 36,277,501 (GRCm39) T1776S possibly damaging Het
Gm4846 A T 1: 166,323,441 (GRCm39) M94K possibly damaging Het
Ighv2-5 G A 12: 113,649,358 (GRCm39) Q32* probably null Het
Klc2 T C 19: 5,161,660 (GRCm39) E310G probably damaging Het
Krt75 A G 15: 101,478,707 (GRCm39) M309T probably damaging Het
Lrp11 G A 10: 7,465,936 (GRCm39) G41R unknown Het
Lrrc52 G T 1: 167,293,664 (GRCm39) P207Q probably benign Het
Lrrc52 G T 1: 167,293,665 (GRCm39) P207T probably benign Het
Lrrk2 A T 15: 91,696,526 (GRCm39) D2438V probably damaging Het
Mycbp C T 4: 123,799,094 (GRCm39) T28M probably damaging Het
Myh14 A G 7: 44,281,846 (GRCm39) V804A probably benign Het
Myo16 A G 8: 10,426,238 (GRCm39) I332V unknown Het
Ncor1 G T 11: 62,208,794 (GRCm39) Q1359K probably benign Het
Oog3 T C 4: 143,884,889 (GRCm39) D349G probably benign Het
Or12e1 A T 2: 87,022,594 (GRCm39) I188L probably benign Het
Or1j21 A G 2: 36,683,943 (GRCm39) K232E probably benign Het
Or52b4i A G 7: 102,191,830 (GRCm39) H229R probably benign Het
Or8k53 A G 2: 86,178,006 (GRCm39) Y35H possibly damaging Het
Pate4 A G 9: 35,519,595 (GRCm39) S32P possibly damaging Het
Pcdhb7 A C 18: 37,475,514 (GRCm39) S217R probably benign Het
Pde1c G A 6: 56,103,910 (GRCm39) R580C probably damaging Het
Pi4ka C A 16: 17,111,841 (GRCm39) A1545S Het
Pign G T 1: 105,575,842 (GRCm39) T266K possibly damaging Het
Pitpnm2 A G 5: 124,260,090 (GRCm39) I1134T probably benign Het
Ppfia2 G A 10: 106,666,520 (GRCm39) V409I possibly damaging Het
Prr7 A G 13: 55,620,609 (GRCm39) T206A probably benign Het
Rnf13 A T 3: 57,727,955 (GRCm39) R212* probably null Het
Rwdd2b T C 16: 87,231,500 (GRCm39) N218S probably benign Het
Serpina3m A G 12: 104,355,834 (GRCm39) D167G possibly damaging Het
Slit2 A T 5: 48,142,547 (GRCm39) N56Y probably damaging Het
Sprr3 G T 3: 92,364,592 (GRCm39) T84K probably damaging Het
Stab2 A T 10: 86,709,766 (GRCm39) H1626Q possibly damaging Het
Tex2 C A 11: 106,437,721 (GRCm39) D650Y unknown Het
Tmprss6 A G 15: 78,330,926 (GRCm39) S436P probably benign Het
Uba2 A C 7: 33,864,860 (GRCm39) F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 (GRCm39) S242L probably damaging Het
Vmn1r86 T G 7: 12,836,685 (GRCm39) I64L probably benign Het
Vmn2r67 A T 7: 84,785,662 (GRCm39) V781E probably damaging Het
Vmn2r80 T A 10: 79,030,097 (GRCm39) F641Y probably damaging Het
Wdfy4 A T 14: 32,800,231 (GRCm39) I1965K Het
Wdr90 G T 17: 26,073,083 (GRCm39) F837L probably benign Het
Xpo4 A G 14: 57,834,468 (GRCm39) V704A possibly damaging Het
Zc3h12d A G 10: 7,743,033 (GRCm39) K268E probably damaging Het
Other mutations in Wdr25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Wdr25 APN 12 108,990,953 (GRCm39) missense possibly damaging 0.89
IGL02479:Wdr25 APN 12 108,864,527 (GRCm39) missense probably benign
IGL02672:Wdr25 APN 12 108,864,007 (GRCm39) nonsense probably null
IGL03329:Wdr25 APN 12 108,864,262 (GRCm39) missense probably benign
R1061:Wdr25 UTSW 12 108,958,725 (GRCm39) splice site probably null
R1402:Wdr25 UTSW 12 108,992,465 (GRCm39) missense probably damaging 1.00
R1402:Wdr25 UTSW 12 108,992,465 (GRCm39) missense probably damaging 1.00
R1582:Wdr25 UTSW 12 108,863,980 (GRCm39) missense possibly damaging 0.94
R1764:Wdr25 UTSW 12 108,992,364 (GRCm39) nonsense probably null
R1954:Wdr25 UTSW 12 108,864,467 (GRCm39) missense probably damaging 0.99
R2258:Wdr25 UTSW 12 108,864,100 (GRCm39) missense possibly damaging 0.94
R3770:Wdr25 UTSW 12 108,864,346 (GRCm39) missense probably damaging 0.97
R3803:Wdr25 UTSW 12 108,864,479 (GRCm39) missense probably damaging 1.00
R3948:Wdr25 UTSW 12 108,993,208 (GRCm39) missense probably benign 0.02
R4183:Wdr25 UTSW 12 108,993,257 (GRCm39) missense probably benign 0.00
R5246:Wdr25 UTSW 12 108,993,382 (GRCm39) missense probably benign 0.06
R5290:Wdr25 UTSW 12 108,863,968 (GRCm39) missense probably benign 0.26
R5305:Wdr25 UTSW 12 108,992,366 (GRCm39) missense probably damaging 1.00
R5813:Wdr25 UTSW 12 108,993,347 (GRCm39) missense possibly damaging 0.47
R5942:Wdr25 UTSW 12 108,864,392 (GRCm39) missense probably benign 0.00
R6386:Wdr25 UTSW 12 108,990,991 (GRCm39) missense probably damaging 1.00
R7171:Wdr25 UTSW 12 108,990,922 (GRCm39) missense probably damaging 0.98
R7449:Wdr25 UTSW 12 108,992,367 (GRCm39) missense probably damaging 1.00
R7616:Wdr25 UTSW 12 108,958,819 (GRCm39) missense possibly damaging 0.73
R7617:Wdr25 UTSW 12 108,958,819 (GRCm39) missense possibly damaging 0.73
R7619:Wdr25 UTSW 12 108,958,819 (GRCm39) missense possibly damaging 0.73
R7623:Wdr25 UTSW 12 108,958,819 (GRCm39) missense possibly damaging 0.73
R7984:Wdr25 UTSW 12 108,976,983 (GRCm39) splice site probably null
R8504:Wdr25 UTSW 12 108,992,393 (GRCm39) nonsense probably null
R9598:Wdr25 UTSW 12 108,864,613 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GTCTATACTGGACCGCATAGGG -3'
(R):5'- CTCTCATAGAAAGGCTGGCC -3'

Sequencing Primer
(F):5'- ACCGCATAGGGCCATGGTG -3'
(R):5'- TGCACTGAGTACACAGCTTAGTCAG -3'
Posted On 2019-10-24