Mutagenetix > Incidental Mutation

Incidental Mutation 'R7622:Xpo4'

589218

Institutional Source

Beutler Lab

Gene Symbol

Xpo4

Ensembl Gene

ENSMUSG00000021952

Gene Name

exportin 4

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.677) question?

Stock #

R7622 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57577521-57665430 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57597011 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 704 (V704A)

Ref Sequence

ENSEMBL: ENSMUSP00000133280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174152] [ENSMUST00000174545]

AlphaFold

Q9ESJ0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089482
AA Change: V704A

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: V704A

Domain	Start	End	E-Value	Type
Blast:IBN_N	37	103	8e-19	BLAST
low complexity region	165	174	N/A	INTRINSIC
low complexity region	459	468	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
Pfam:CRM1_C	954	1144	6.3e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174152

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174545
AA Change: V704A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: V704A

Domain	Start	End	E-Value	Type
Blast:IBN_N	37	103	8e-19	BLAST
low complexity region	165	174	N/A	INTRINSIC
low complexity region	459	468	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
Pfam:CRM1_C	952	1143	5.2e-9	PFAM

Meta Mutation Damage Score

0.1698

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,948,413	C1502*	probably null	Het
Adgrd1	G	A	5: 129,139,624	D384N	probably benign	Het
Aqp8	T	C	7: 123,466,660	F226S	possibly damaging	Het
Arl6ip6	A	G	2: 53,217,327	Y207C	probably damaging	Het
Cbfa2t2	A	G	2: 154,500,445	E27G	possibly damaging	Het
Cdc42bpb	T	G	12: 111,294,772	E201A	unknown	Het
Cfap54	A	C	10: 92,956,944	V1769G	unknown	Het
Dmxl2	C	T	9: 54,472,218	G7S	probably damaging	Het
Dnah6	G	T	6: 73,124,759	F1927L	possibly damaging	Het
Dnajc6	A	G	4: 101,640,491	E942G	probably damaging	Het
Fam170a	A	G	18: 50,282,902	R324G	probably benign	Het
Gapdhs	G	A	7: 30,739,331	T9I	unknown	Het
Gm10320	T	A	13: 98,489,724	R51*	probably null	Het
Gm19410	A	T	8: 35,810,347	T1776S	possibly damaging	Het
Gm4846	A	T	1: 166,495,872	M94K	possibly damaging	Het
Ighv2-5	G	A	12: 113,685,738	Q32*	probably null	Het
Klc2	T	C	19: 5,111,632	E310G	probably damaging	Het
Krt75	A	G	15: 101,570,272	M309T	probably damaging	Het
Lrp11	G	A	10: 7,590,172	G41R	unknown	Het
Lrrc52	G	T	1: 167,466,095	P207Q	probably benign	Het
Lrrc52	G	T	1: 167,466,096	P207T	probably benign	Het
Lrrk2	A	T	15: 91,812,323	D2438V	probably damaging	Het
Mycbp	C	T	4: 123,905,301	T28M	probably damaging	Het
Myh14	A	G	7: 44,632,422	V804A	probably benign	Het
Myo16	A	G	8: 10,376,238	I332V	unknown	Het
Ncor1	G	T	11: 62,317,968	Q1359K	probably benign	Het
Olfr1055	A	G	2: 86,347,662	Y35H	possibly damaging	Het
Olfr1112	A	T	2: 87,192,250	I188L	probably benign	Het
Olfr50	A	G	2: 36,793,931	K232E	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,623	H229R	probably benign	Het
Oog3	T	C	4: 144,158,319	D349G	probably benign	Het
Pate4	A	G	9: 35,608,299	S32P	possibly damaging	Het
Pcdhb7	A	C	18: 37,342,461	S217R	probably benign	Het
Pde1c	G	A	6: 56,126,925	R580C	probably damaging	Het
Pi4ka	C	A	16: 17,293,977	A1545S		Het
Pign	G	T	1: 105,648,117	T266K	possibly damaging	Het
Pitpnm2	A	G	5: 124,122,027	I1134T	probably benign	Het
Ppfia2	G	A	10: 106,830,659	V409I	possibly damaging	Het
Prr7	A	G	13: 55,472,796	T206A	probably benign	Het
Rnf13	A	T	3: 57,820,534	R212*	probably null	Het
Rwdd2b	T	C	16: 87,434,612	N218S	probably benign	Het
Serpina3m	A	G	12: 104,389,575	D167G	possibly damaging	Het
Slit2	A	T	5: 47,985,205	N56Y	probably damaging	Het
Sprr3	G	T	3: 92,457,285	T84K	probably damaging	Het
Stab2	A	T	10: 86,873,902	H1626Q	possibly damaging	Het
Tex2	C	A	11: 106,546,895	D650Y	unknown	Het
Tmprss6	A	G	15: 78,446,726	S436P	probably benign	Het
Uba2	A	C	7: 34,165,435	F63L	probably damaging	Het
Ubxn2b	C	T	4: 6,214,692	S242L	probably damaging	Het
Vmn1r86	T	G	7: 13,102,758	I64L	probably benign	Het
Vmn2r67	A	T	7: 85,136,454	V781E	probably damaging	Het
Vmn2r80	T	A	10: 79,194,263	F641Y	probably damaging	Het
Wdfy4	A	T	14: 33,078,274	I1965K		Het
Wdr25	G	A	12: 108,992,893	G344S	possibly damaging	Het
Wdr90	G	T	17: 25,854,109	F837L	probably benign	Het
Zc3h12d	A	G	10: 7,867,269	K268E	probably damaging	Het

Other mutations in Xpo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01944:Xpo4	APN	14	57604398	missense	probably benign
IGL02537:Xpo4	APN	14	57593833	missense	probably benign
IGL02554:Xpo4	APN	14	57590088	missense	probably benign	0.00
IGL02826:Xpo4	APN	14	57629420	missense	possibly damaging	0.50
IGL03071:Xpo4	APN	14	57618228	missense	possibly damaging	0.66
PIT4131001:Xpo4	UTSW	14	57584611	missense	probably null	0.98
R0245:Xpo4	UTSW	14	57630240	missense	probably damaging	1.00
R0546:Xpo4	UTSW	14	57613274	missense	probably benign	0.07
R0606:Xpo4	UTSW	14	57638208	unclassified	probably benign
R0761:Xpo4	UTSW	14	57613383	missense	probably damaging	0.99
R1775:Xpo4	UTSW	14	57603672	missense	probably benign
R1853:Xpo4	UTSW	14	57585907	missense	possibly damaging	0.72
R1923:Xpo4	UTSW	14	57590871	missense	probably damaging	0.98
R2007:Xpo4	UTSW	14	57586644	missense	probably null	0.19
R2035:Xpo4	UTSW	14	57585926	missense	possibly damaging	0.57
R2174:Xpo4	UTSW	14	57590090	missense	probably damaging	1.00
R2421:Xpo4	UTSW	14	57629503	missense	probably benign	0.00
R2937:Xpo4	UTSW	14	57604440	missense	probably benign	0.03
R2938:Xpo4	UTSW	14	57604440	missense	probably benign	0.03
R4066:Xpo4	UTSW	14	57588054	missense	probably benign	0.07
R4086:Xpo4	UTSW	14	57643033	intron	probably benign
R4373:Xpo4	UTSW	14	57591022	nonsense	probably null
R4620:Xpo4	UTSW	14	57630325	missense	probably damaging	1.00
R4703:Xpo4	UTSW	14	57590108	missense	probably benign	0.01
R4755:Xpo4	UTSW	14	57618181	missense	probably benign	0.01
R4831:Xpo4	UTSW	14	57590102	missense	probably damaging	1.00
R4905:Xpo4	UTSW	14	57638289	missense	possibly damaging	0.70
R4943:Xpo4	UTSW	14	57638240	missense	possibly damaging	0.68
R5074:Xpo4	UTSW	14	57584641	missense	probably benign	0.02
R5279:Xpo4	UTSW	14	57613409	missense	probably benign	0.37
R5375:Xpo4	UTSW	14	57638307	missense	probably damaging	0.99
R5690:Xpo4	UTSW	14	57590989	missense	probably benign	0.03
R5936:Xpo4	UTSW	14	57643499	missense	probably benign
R6393:Xpo4	UTSW	14	57638313	missense	probably damaging	1.00
R6824:Xpo4	UTSW	14	57613403	missense	probably damaging	1.00
R6893:Xpo4	UTSW	14	57582310	missense	probably benign
R6923:Xpo4	UTSW	14	57603711	missense	probably benign	0.19
R7028:Xpo4	UTSW	14	57597051	missense	probably benign	0.22
R7442:Xpo4	UTSW	14	57630223	missense	probably benign	0.00
R7469:Xpo4	UTSW	14	57597979	missense	probably benign
R7490:Xpo4	UTSW	14	57602621	frame shift	probably null
R7667:Xpo4	UTSW	14	57589959	missense	probably damaging	0.97
R7789:Xpo4	UTSW	14	57613349	missense	probably benign	0.00
R7895:Xpo4	UTSW	14	57602591	missense	probably benign	0.03
R8000:Xpo4	UTSW	14	57589946	missense	probably damaging	1.00
R8372:Xpo4	UTSW	14	57597884	critical splice donor site	probably null
R8395:Xpo4	UTSW	14	57648467	missense	probably benign	0.01
R8420:Xpo4	UTSW	14	57604456	missense	probably damaging	0.99
R8836:Xpo4	UTSW	14	57664910	missense	probably benign	0.03
R8841:Xpo4	UTSW	14	57597956	missense	probably damaging	0.97
R8989:Xpo4	UTSW	14	57591018	missense	probably benign	0.00
R9229:Xpo4	UTSW	14	57613699	missense	probably benign
R9374:Xpo4	UTSW	14	57591055	missense	possibly damaging	0.94
R9551:Xpo4	UTSW	14	57591055	missense	possibly damaging	0.94
R9628:Xpo4	UTSW	14	57605173	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGAAAGCTAAGCTCCCACATG -3'
(R):5'- CTTCAGGGTTCGATGCTAATTTC -3'

Sequencing Primer
(F):5'- AGCTAAGCTCCCACATGCATTTG -3'
(R):5'- AGTGGATTATCGGCTACC -3'

Posted On

2019-10-24