Incidental Mutation 'R7622:Tmprss6'
ID589219
Institutional Source Beutler Lab
Gene Symbol Tmprss6
Ensembl Gene ENSMUSG00000016942
Gene Nametransmembrane serine protease 6
Synonymsmatriptase-2, 1300008A22Rik
MMRRC Submission
Accession Numbers

ENSMUST00000017086; MGI: 1919003

Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7622 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78439667-78468634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78446726 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 436 (S436P)
Ref Sequence ENSEMBL: ENSMUSP00000017086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017086] [ENSMUST00000229124] [ENSMUST00000229516] [ENSMUST00000230020] [ENSMUST00000230159] [ENSMUST00000230226]
Predicted Effect probably benign
Transcript: ENSMUST00000017086
AA Change: S436P

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000017086
Gene: ENSMUSG00000016942
AA Change: S436P

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:SEA 88 191 3.2e-13 PFAM
CUB 341 452 3.82e-2 SMART
LDLa 457 489 1.33e-2 SMART
LDLa 490 527 2.31e-9 SMART
LDLa 530 568 1.07e-4 SMART
Tryp_SPc 576 806 3.75e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229124
AA Change: S34P

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000229516
AA Change: S436P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000230020
Predicted Effect probably benign
Transcript: ENSMUST00000230159
AA Change: S436P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000230226
AA Change: S424P

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
Meta Mutation Damage Score 0.8195 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II transmembrane serine proteinase that is found attached to the cell surface. The encoded protein may be involved in matrix remodeling processes in the liver. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygosity for an inactivating mutation of this gene results in hair loss over the entire body except the face, microcytic anemia and female infertility, all reversible by dietary iron supplementation. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(6) Gene trapped(2) Chemically induced(3)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,948,413 C1502* probably null Het
Adgrd1 G A 5: 129,139,624 D384N probably benign Het
Aqp8 T C 7: 123,466,660 F226S possibly damaging Het
Arl6ip6 A G 2: 53,217,327 Y207C probably damaging Het
Cbfa2t2 A G 2: 154,500,445 E27G possibly damaging Het
Cdc42bpb T G 12: 111,294,772 E201A unknown Het
Cfap54 A C 10: 92,956,944 V1769G unknown Het
Dmxl2 C T 9: 54,472,218 G7S probably damaging Het
Dnah6 G T 6: 73,124,759 F1927L possibly damaging Het
Dnajc6 A G 4: 101,640,491 E942G probably damaging Het
Fam170a A G 18: 50,282,902 R324G probably benign Het
Gapdhs G A 7: 30,739,331 T9I unknown Het
Gm10320 T A 13: 98,489,724 R51* probably null Het
Gm19410 A T 8: 35,810,347 T1776S possibly damaging Het
Gm4846 A T 1: 166,495,872 M94K possibly damaging Het
Ighv2-5 G A 12: 113,685,738 Q32* probably null Het
Klc2 T C 19: 5,111,632 E310G probably damaging Het
Krt75 A G 15: 101,570,272 M309T probably damaging Het
Lrp11 G A 10: 7,590,172 G41R unknown Het
Lrrc52 G T 1: 167,466,095 P207Q probably benign Het
Lrrc52 G T 1: 167,466,096 P207T probably benign Het
Lrrk2 A T 15: 91,812,323 D2438V probably damaging Het
Mycbp C T 4: 123,905,301 T28M probably damaging Het
Myh14 A G 7: 44,632,422 V804A probably benign Het
Myo16 A G 8: 10,376,238 I332V unknown Het
Ncor1 G T 11: 62,317,968 Q1359K probably benign Het
Olfr1055 A G 2: 86,347,662 Y35H possibly damaging Het
Olfr1112 A T 2: 87,192,250 I188L probably benign Het
Olfr50 A G 2: 36,793,931 K232E probably benign Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Oog3 T C 4: 144,158,319 D349G probably benign Het
Pate4 A G 9: 35,608,299 S32P possibly damaging Het
Pcdhb7 A C 18: 37,342,461 S217R probably benign Het
Pde1c G A 6: 56,126,925 R580C probably damaging Het
Pi4ka C A 16: 17,293,977 A1545S Het
Pign G T 1: 105,648,117 T266K possibly damaging Het
Pitpnm2 A G 5: 124,122,027 I1134T probably benign Het
Ppfia2 G A 10: 106,830,659 V409I possibly damaging Het
Prr7 A G 13: 55,472,796 T206A probably benign Het
Rnf13 A T 3: 57,820,534 R212* probably null Het
Rwdd2b T C 16: 87,434,612 N218S probably benign Het
Serpina3m A G 12: 104,389,575 D167G possibly damaging Het
Slit2 A T 5: 47,985,205 N56Y probably damaging Het
Sprr3 G T 3: 92,457,285 T84K probably damaging Het
Stab2 A T 10: 86,873,902 H1626Q possibly damaging Het
Tex2 C A 11: 106,546,895 D650Y unknown Het
Uba2 A C 7: 34,165,435 F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 S242L probably damaging Het
Vmn1r86 T G 7: 13,102,758 I64L probably benign Het
Vmn2r67 A T 7: 85,136,454 V781E probably damaging Het
Vmn2r80 T A 10: 79,194,263 F641Y probably damaging Het
Wdfy4 A T 14: 33,078,274 I1965K Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Wdr90 G T 17: 25,854,109 F837L probably benign Het
Xpo4 A G 14: 57,597,011 V704A possibly damaging Het
Zc3h12d A G 10: 7,867,269 K268E probably damaging Het
Other mutations in Tmprss6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tmprss6 APN 15 78442434 missense probably null 1.00
IGL02474:Tmprss6 APN 15 78442336 missense probably damaging 0.99
cubone UTSW 15 78446657 splice site probably null
Ekans UTSW 15 78459427 splice site probably null
mask UTSW 15 78464455 intron probably benign
masquerade UTSW 15 78468000 intron probably benign
zorro UTSW 15 78464552 intron probably benign
BB003:Tmprss6 UTSW 15 78452850 missense probably benign 0.28
BB013:Tmprss6 UTSW 15 78452850 missense probably benign 0.28
PIT1430001:Tmprss6 UTSW 15 78440627 missense probably damaging 1.00
R0285:Tmprss6 UTSW 15 78452868 missense probably damaging 0.99
R1857:Tmprss6 UTSW 15 78452552 missense probably damaging 1.00
R2432:Tmprss6 UTSW 15 78465104 splice site probably benign
R4192:Tmprss6 UTSW 15 78446657 splice site probably null
R4226:Tmprss6 UTSW 15 78446699 missense probably damaging 1.00
R4227:Tmprss6 UTSW 15 78446699 missense probably damaging 1.00
R4334:Tmprss6 UTSW 15 78459427 splice site probably null
R4344:Tmprss6 UTSW 15 78459427 splice site probably null
R4446:Tmprss6 UTSW 15 78452839 missense probably damaging 1.00
R4508:Tmprss6 UTSW 15 78459778 missense probably damaging 1.00
R4643:Tmprss6 UTSW 15 78445356 missense probably damaging 0.98
R4743:Tmprss6 UTSW 15 78443710 missense probably damaging 0.99
R4836:Tmprss6 UTSW 15 78445388 missense probably damaging 1.00
R4859:Tmprss6 UTSW 15 78446677 missense probably damaging 0.99
R4869:Tmprss6 UTSW 15 78443680 splice site probably null
R5197:Tmprss6 UTSW 15 78454189 missense probably damaging 1.00
R5212:Tmprss6 UTSW 15 78446260 missense probably damaging 0.99
R5225:Tmprss6 UTSW 15 78452507 missense probably damaging 0.97
R5569:Tmprss6 UTSW 15 78440303 missense probably damaging 1.00
R5572:Tmprss6 UTSW 15 78442422 missense probably damaging 1.00
R5669:Tmprss6 UTSW 15 78454956 missense possibly damaging 0.86
R5947:Tmprss6 UTSW 15 78452522 missense probably damaging 1.00
R6800:Tmprss6 UTSW 15 78440257 missense probably damaging 1.00
R6941:Tmprss6 UTSW 15 78446777 missense probably damaging 1.00
R6965:Tmprss6 UTSW 15 78444128 missense probably damaging 1.00
R7334:Tmprss6 UTSW 15 78443817 missense unknown
R7338:Tmprss6 UTSW 15 78459819 missense probably damaging 1.00
R7926:Tmprss6 UTSW 15 78452850 missense probably benign 0.28
R7992:Tmprss6 UTSW 15 78442464 missense probably benign 0.11
R8177:Tmprss6 UTSW 15 78465127 missense probably benign 0.01
R8792:Tmprss6 UTSW 15 78444128 missense probably damaging 1.00
R8881:Tmprss6 UTSW 15 78443787 makesense probably null
X0025:Tmprss6 UTSW 15 78455095 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACATGTGACTGCCTACCCAG -3'
(R):5'- TGGCTGTGCATAGGAACCTAG -3'

Sequencing Primer
(F):5'- GACACATAGCACTCTCACTGTGG -3'
(R):5'- GCATAGGAACCTAGGTTGTTTCTC -3'
Posted On2019-10-24