Incidental Mutation 'R7622:Krt75'
ID 589221
Institutional Source Beutler Lab
Gene Symbol Krt75
Ensembl Gene ENSMUSG00000022986
Gene Name keratin 75
Synonyms Krt2-6hf, Krtcap1, 4732468K03Rik, K6hf
MMRRC Submission 045717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R7622 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 101471780-101482339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101478707 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 309 (M309T)
Ref Sequence ENSEMBL: ENSMUSP00000036246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042957]
AlphaFold Q8BGZ7
Predicted Effect probably damaging
Transcript: ENSMUST00000042957
AA Change: M309T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036246
Gene: ENSMUSG00000022986
AA Change: M309T

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 146 1e-32 PFAM
Filament 149 462 1.68e-178 SMART
low complexity region 468 527 N/A INTRINSIC
Meta Mutation Damage Score 0.7769 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. This gene is expressed in the companion layer, upper germinative matrix region of the hair follicle, and medulla of the hair shaft. The encoded protein plays an essential role in hair and nail formation. Variations in this gene have been associated with the hair disorders pseudofolliculitis barbae (PFB) and loose anagen hair syndrome (LAHS). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-in mutation that results in the deletion of the highly conserved asparagine residue (N159) in the helix initiation peptide of this gene develop hair shaft and nail abnormalities resembling pachyonychia congenita. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 G A 5: 129,216,688 (GRCm39) D384N probably benign Het
Aqp8 T C 7: 123,065,883 (GRCm39) F226S possibly damaging Het
Arl6ip6 A G 2: 53,107,339 (GRCm39) Y207C probably damaging Het
Bltp1 C A 3: 37,002,562 (GRCm39) C1502* probably null Het
Cbfa2t2 A G 2: 154,342,365 (GRCm39) E27G possibly damaging Het
Cdc42bpb T G 12: 111,261,206 (GRCm39) E201A unknown Het
Cfap54 A C 10: 92,792,806 (GRCm39) V1769G unknown Het
Dmxl2 C T 9: 54,379,502 (GRCm39) G7S probably damaging Het
Dnah6 G T 6: 73,101,742 (GRCm39) F1927L possibly damaging Het
Dnajc6 A G 4: 101,497,688 (GRCm39) E942G probably damaging Het
Fam170a A G 18: 50,415,969 (GRCm39) R324G probably benign Het
Gapdhs G A 7: 30,438,756 (GRCm39) T9I unknown Het
Gm10320 T A 13: 98,626,232 (GRCm39) R51* probably null Het
Gm19410 A T 8: 36,277,501 (GRCm39) T1776S possibly damaging Het
Gm4846 A T 1: 166,323,441 (GRCm39) M94K possibly damaging Het
Ighv2-5 G A 12: 113,649,358 (GRCm39) Q32* probably null Het
Klc2 T C 19: 5,161,660 (GRCm39) E310G probably damaging Het
Lrp11 G A 10: 7,465,936 (GRCm39) G41R unknown Het
Lrrc52 G T 1: 167,293,664 (GRCm39) P207Q probably benign Het
Lrrc52 G T 1: 167,293,665 (GRCm39) P207T probably benign Het
Lrrk2 A T 15: 91,696,526 (GRCm39) D2438V probably damaging Het
Mycbp C T 4: 123,799,094 (GRCm39) T28M probably damaging Het
Myh14 A G 7: 44,281,846 (GRCm39) V804A probably benign Het
Myo16 A G 8: 10,426,238 (GRCm39) I332V unknown Het
Ncor1 G T 11: 62,208,794 (GRCm39) Q1359K probably benign Het
Oog3 T C 4: 143,884,889 (GRCm39) D349G probably benign Het
Or12e1 A T 2: 87,022,594 (GRCm39) I188L probably benign Het
Or1j21 A G 2: 36,683,943 (GRCm39) K232E probably benign Het
Or52b4i A G 7: 102,191,830 (GRCm39) H229R probably benign Het
Or8k53 A G 2: 86,178,006 (GRCm39) Y35H possibly damaging Het
Pate4 A G 9: 35,519,595 (GRCm39) S32P possibly damaging Het
Pcdhb7 A C 18: 37,475,514 (GRCm39) S217R probably benign Het
Pde1c G A 6: 56,103,910 (GRCm39) R580C probably damaging Het
Pi4ka C A 16: 17,111,841 (GRCm39) A1545S Het
Pign G T 1: 105,575,842 (GRCm39) T266K possibly damaging Het
Pitpnm2 A G 5: 124,260,090 (GRCm39) I1134T probably benign Het
Ppfia2 G A 10: 106,666,520 (GRCm39) V409I possibly damaging Het
Prr7 A G 13: 55,620,609 (GRCm39) T206A probably benign Het
Rnf13 A T 3: 57,727,955 (GRCm39) R212* probably null Het
Rwdd2b T C 16: 87,231,500 (GRCm39) N218S probably benign Het
Serpina3m A G 12: 104,355,834 (GRCm39) D167G possibly damaging Het
Slit2 A T 5: 48,142,547 (GRCm39) N56Y probably damaging Het
Sprr3 G T 3: 92,364,592 (GRCm39) T84K probably damaging Het
Stab2 A T 10: 86,709,766 (GRCm39) H1626Q possibly damaging Het
Tex2 C A 11: 106,437,721 (GRCm39) D650Y unknown Het
Tmprss6 A G 15: 78,330,926 (GRCm39) S436P probably benign Het
Uba2 A C 7: 33,864,860 (GRCm39) F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 (GRCm39) S242L probably damaging Het
Vmn1r86 T G 7: 12,836,685 (GRCm39) I64L probably benign Het
Vmn2r67 A T 7: 84,785,662 (GRCm39) V781E probably damaging Het
Vmn2r80 T A 10: 79,030,097 (GRCm39) F641Y probably damaging Het
Wdfy4 A T 14: 32,800,231 (GRCm39) I1965K Het
Wdr25 G A 12: 108,958,819 (GRCm39) G344S possibly damaging Het
Wdr90 G T 17: 26,073,083 (GRCm39) F837L probably benign Het
Xpo4 A G 14: 57,834,468 (GRCm39) V704A possibly damaging Het
Zc3h12d A G 10: 7,743,033 (GRCm39) K268E probably damaging Het
Other mutations in Krt75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Krt75 APN 15 101,481,081 (GRCm39) missense probably benign
IGL01406:Krt75 APN 15 101,476,460 (GRCm39) missense probably damaging 1.00
IGL01783:Krt75 APN 15 101,473,364 (GRCm39) missense probably benign 0.01
IGL01911:Krt75 APN 15 101,476,537 (GRCm39) missense probably damaging 1.00
IGL01945:Krt75 APN 15 101,478,599 (GRCm39) missense possibly damaging 0.56
IGL02178:Krt75 APN 15 101,481,226 (GRCm39) missense probably benign 0.00
IGL02832:Krt75 APN 15 101,476,508 (GRCm39) missense probably benign 0.02
IGL03173:Krt75 APN 15 101,481,162 (GRCm39) missense probably damaging 1.00
IGL03276:Krt75 APN 15 101,476,811 (GRCm39) missense probably damaging 0.98
BB007:Krt75 UTSW 15 101,473,318 (GRCm39) makesense probably null
BB017:Krt75 UTSW 15 101,473,318 (GRCm39) makesense probably null
R0482:Krt75 UTSW 15 101,478,746 (GRCm39) missense probably benign 0.22
R0595:Krt75 UTSW 15 101,476,789 (GRCm39) missense probably damaging 1.00
R0626:Krt75 UTSW 15 101,482,025 (GRCm39) missense probably benign 0.05
R1495:Krt75 UTSW 15 101,482,308 (GRCm39) start gained probably benign
R1886:Krt75 UTSW 15 101,479,532 (GRCm39) missense probably damaging 0.97
R1906:Krt75 UTSW 15 101,481,801 (GRCm39) missense possibly damaging 0.66
R1907:Krt75 UTSW 15 101,481,801 (GRCm39) missense possibly damaging 0.66
R2055:Krt75 UTSW 15 101,481,196 (GRCm39) missense probably benign 0.08
R2504:Krt75 UTSW 15 101,476,466 (GRCm39) missense probably benign 0.27
R2930:Krt75 UTSW 15 101,476,466 (GRCm39) missense probably benign 0.27
R3788:Krt75 UTSW 15 101,481,956 (GRCm39) missense possibly damaging 0.94
R4494:Krt75 UTSW 15 101,480,136 (GRCm39) nonsense probably null
R4803:Krt75 UTSW 15 101,476,507 (GRCm39) missense probably benign 0.00
R4868:Krt75 UTSW 15 101,476,556 (GRCm39) missense probably damaging 1.00
R4906:Krt75 UTSW 15 101,478,674 (GRCm39) missense probably damaging 1.00
R4969:Krt75 UTSW 15 101,482,248 (GRCm39) missense probably benign
R5069:Krt75 UTSW 15 101,474,673 (GRCm39) critical splice donor site probably null
R5446:Krt75 UTSW 15 101,479,502 (GRCm39) missense probably null 0.22
R6019:Krt75 UTSW 15 101,482,158 (GRCm39) missense probably benign 0.00
R6739:Krt75 UTSW 15 101,479,503 (GRCm39) missense probably benign 0.00
R6835:Krt75 UTSW 15 101,479,472 (GRCm39) missense probably benign 0.16
R7167:Krt75 UTSW 15 101,476,750 (GRCm39) missense possibly damaging 0.90
R7930:Krt75 UTSW 15 101,473,318 (GRCm39) makesense probably null
R8046:Krt75 UTSW 15 101,481,199 (GRCm39) missense probably benign 0.01
R8943:Krt75 UTSW 15 101,476,767 (GRCm39) missense probably benign 0.03
R9360:Krt75 UTSW 15 101,476,729 (GRCm39) missense probably damaging 1.00
R9483:Krt75 UTSW 15 101,482,238 (GRCm39) missense probably benign 0.01
R9609:Krt75 UTSW 15 101,474,677 (GRCm39) missense probably benign 0.33
X0022:Krt75 UTSW 15 101,478,648 (GRCm39) missense possibly damaging 0.94
Z1088:Krt75 UTSW 15 101,482,100 (GRCm39) missense probably benign 0.00
Z1177:Krt75 UTSW 15 101,479,489 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTGTGCAGTTTCCGTGAG -3'
(R):5'- CTCCCGGGGACATGATTAACAG -3'

Sequencing Primer
(F):5'- TGAGGGATGTGAAGGAGTGC -3'
(R):5'- CGGGGACATGATTAACAGGACTG -3'
Posted On 2019-10-24