Incidental Mutation 'R7622:Pi4ka'
ID 589222
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Name phosphatidylinositol 4-kinase alpha
Synonyms Pik4ca
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7622 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 17280351-17406314 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 17293977 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 1545 (A1545S)
Ref Sequence ENSEMBL: ENSMUSP00000036162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000232232]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: A1545S

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231683
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,948,413 C1502* probably null Het
Adgrd1 G A 5: 129,139,624 D384N probably benign Het
Aqp8 T C 7: 123,466,660 F226S possibly damaging Het
Arl6ip6 A G 2: 53,217,327 Y207C probably damaging Het
Cbfa2t2 A G 2: 154,500,445 E27G possibly damaging Het
Cdc42bpb T G 12: 111,294,772 E201A unknown Het
Cfap54 A C 10: 92,956,944 V1769G unknown Het
Dmxl2 C T 9: 54,472,218 G7S probably damaging Het
Dnah6 G T 6: 73,124,759 F1927L possibly damaging Het
Dnajc6 A G 4: 101,640,491 E942G probably damaging Het
Fam170a A G 18: 50,282,902 R324G probably benign Het
Gapdhs G A 7: 30,739,331 T9I unknown Het
Gm10320 T A 13: 98,489,724 R51* probably null Het
Gm19410 A T 8: 35,810,347 T1776S possibly damaging Het
Gm4846 A T 1: 166,495,872 M94K possibly damaging Het
Ighv2-5 G A 12: 113,685,738 Q32* probably null Het
Klc2 T C 19: 5,111,632 E310G probably damaging Het
Krt75 A G 15: 101,570,272 M309T probably damaging Het
Lrp11 G A 10: 7,590,172 G41R unknown Het
Lrrc52 G T 1: 167,466,095 P207Q probably benign Het
Lrrc52 G T 1: 167,466,096 P207T probably benign Het
Lrrk2 A T 15: 91,812,323 D2438V probably damaging Het
Mycbp C T 4: 123,905,301 T28M probably damaging Het
Myh14 A G 7: 44,632,422 V804A probably benign Het
Myo16 A G 8: 10,376,238 I332V unknown Het
Ncor1 G T 11: 62,317,968 Q1359K probably benign Het
Olfr1055 A G 2: 86,347,662 Y35H possibly damaging Het
Olfr1112 A T 2: 87,192,250 I188L probably benign Het
Olfr50 A G 2: 36,793,931 K232E probably benign Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Oog3 T C 4: 144,158,319 D349G probably benign Het
Pate4 A G 9: 35,608,299 S32P possibly damaging Het
Pcdhb7 A C 18: 37,342,461 S217R probably benign Het
Pde1c G A 6: 56,126,925 R580C probably damaging Het
Pign G T 1: 105,648,117 T266K possibly damaging Het
Pitpnm2 A G 5: 124,122,027 I1134T probably benign Het
Ppfia2 G A 10: 106,830,659 V409I possibly damaging Het
Prr7 A G 13: 55,472,796 T206A probably benign Het
Rnf13 A T 3: 57,820,534 R212* probably null Het
Rwdd2b T C 16: 87,434,612 N218S probably benign Het
Serpina3m A G 12: 104,389,575 D167G possibly damaging Het
Slit2 A T 5: 47,985,205 N56Y probably damaging Het
Sprr3 G T 3: 92,457,285 T84K probably damaging Het
Stab2 A T 10: 86,873,902 H1626Q possibly damaging Het
Tex2 C A 11: 106,546,895 D650Y unknown Het
Tmprss6 A G 15: 78,446,726 S436P probably benign Het
Uba2 A C 7: 34,165,435 F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 S242L probably damaging Het
Vmn1r86 T G 7: 13,102,758 I64L probably benign Het
Vmn2r67 A T 7: 85,136,454 V781E probably damaging Het
Vmn2r80 T A 10: 79,194,263 F641Y probably damaging Het
Wdfy4 A T 14: 33,078,274 I1965K Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Wdr90 G T 17: 25,854,109 F837L probably benign Het
Xpo4 A G 14: 57,597,011 V704A possibly damaging Het
Zc3h12d A G 10: 7,867,269 K268E probably damaging Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
dove_bar UTSW 16 17326052 splice site probably null
mia UTSW 16 17376982 missense possibly damaging 0.89
Pia UTSW 16 17281044 missense probably damaging 1.00
G1patch:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
R7533:Pi4ka UTSW 16 17297661 missense
R7552:Pi4ka UTSW 16 17291216 missense
R7581:Pi4ka UTSW 16 17301060 missense
R7717:Pi4ka UTSW 16 17376923 missense
R8048:Pi4ka UTSW 16 17303127 missense
R8052:Pi4ka UTSW 16 17356166 missense
R8079:Pi4ka UTSW 16 17303060 missense
R8123:Pi4ka UTSW 16 17281092 missense
R8211:Pi4ka UTSW 16 17282905 missense
R8310:Pi4ka UTSW 16 17354048 critical splice donor site probably null
R8322:Pi4ka UTSW 16 17357573 missense
R8509:Pi4ka UTSW 16 17354144 missense
R8735:Pi4ka UTSW 16 17318370 missense
R8912:Pi4ka UTSW 16 17389366 missense
R8917:Pi4ka UTSW 16 17312446 missense
R8921:Pi4ka UTSW 16 17307740 missense
R8941:Pi4ka UTSW 16 17296943 unclassified probably benign
R9002:Pi4ka UTSW 16 17299453 missense
R9203:Pi4ka UTSW 16 17282301 missense
R9222:Pi4ka UTSW 16 17358361 missense
R9230:Pi4ka UTSW 16 17281924 missense
R9262:Pi4ka UTSW 16 17302995 missense
R9338:Pi4ka UTSW 16 17317363 missense
R9374:Pi4ka UTSW 16 17307710 missense
R9436:Pi4ka UTSW 16 17307806 missense
R9499:Pi4ka UTSW 16 17307710 missense
R9501:Pi4ka UTSW 16 17386292 missense
R9551:Pi4ka UTSW 16 17307710 missense
R9705:Pi4ka UTSW 16 17281951 missense
RF007:Pi4ka UTSW 16 17297233 missense
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TATACCCTAGGCTAGCTCACAG -3'
(R):5'- TGTAACATGTCAGAAGCACTTTCC -3'

Sequencing Primer
(F):5'- AGCTCACAGGGCTTTAGACTC -3'
(R):5'- CCTTGTAGACTCAGGTTCACAGAG -3'
Posted On 2019-10-24