Incidental Mutation 'R7622:Pcdhb7'
ID 589225
Institutional Source Beutler Lab
Gene Symbol Pcdhb7
Ensembl Gene ENSMUSG00000045062
Gene Name protocadherin beta 7
Synonyms PcdhbG, Pcdhb4B
MMRRC Submission 045717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R7622 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37474755-37478255 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 37475514 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 217 (S217R)
Ref Sequence ENSEMBL: ENSMUSP00000051041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053037] [ENSMUST00000061717] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q8CDY9
Predicted Effect probably benign
Transcript: ENSMUST00000053037
AA Change: S217R

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000051041
Gene: ENSMUSG00000045062
AA Change: S217R

DomainStartEndE-ValueType
Pfam:Cadherin_2 61 143 1.4e-32 PFAM
CA 186 271 5.47e-17 SMART
CA 295 376 4.43e-26 SMART
CA 399 480 1.04e-22 SMART
CA 504 590 2.12e-23 SMART
CA 620 701 5.73e-11 SMART
Pfam:Cadherin_C_2 718 801 5.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061717
SMART Domains Protein: ENSMUSP00000058592
Gene: ENSMUSG00000051678

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.7e-33 PFAM
CA 155 240 1.48e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.69e-22 SMART
CA 472 558 1.65e-25 SMART
CA 588 669 6.24e-12 SMART
Pfam:Cadherin_C_2 685 768 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 G A 5: 129,216,688 (GRCm39) D384N probably benign Het
Aqp8 T C 7: 123,065,883 (GRCm39) F226S possibly damaging Het
Arl6ip6 A G 2: 53,107,339 (GRCm39) Y207C probably damaging Het
Bltp1 C A 3: 37,002,562 (GRCm39) C1502* probably null Het
Cbfa2t2 A G 2: 154,342,365 (GRCm39) E27G possibly damaging Het
Cdc42bpb T G 12: 111,261,206 (GRCm39) E201A unknown Het
Cfap54 A C 10: 92,792,806 (GRCm39) V1769G unknown Het
Dmxl2 C T 9: 54,379,502 (GRCm39) G7S probably damaging Het
Dnah6 G T 6: 73,101,742 (GRCm39) F1927L possibly damaging Het
Dnajc6 A G 4: 101,497,688 (GRCm39) E942G probably damaging Het
Fam170a A G 18: 50,415,969 (GRCm39) R324G probably benign Het
Gapdhs G A 7: 30,438,756 (GRCm39) T9I unknown Het
Gm10320 T A 13: 98,626,232 (GRCm39) R51* probably null Het
Gm19410 A T 8: 36,277,501 (GRCm39) T1776S possibly damaging Het
Gm4846 A T 1: 166,323,441 (GRCm39) M94K possibly damaging Het
Ighv2-5 G A 12: 113,649,358 (GRCm39) Q32* probably null Het
Klc2 T C 19: 5,161,660 (GRCm39) E310G probably damaging Het
Krt75 A G 15: 101,478,707 (GRCm39) M309T probably damaging Het
Lrp11 G A 10: 7,465,936 (GRCm39) G41R unknown Het
Lrrc52 G T 1: 167,293,664 (GRCm39) P207Q probably benign Het
Lrrc52 G T 1: 167,293,665 (GRCm39) P207T probably benign Het
Lrrk2 A T 15: 91,696,526 (GRCm39) D2438V probably damaging Het
Mycbp C T 4: 123,799,094 (GRCm39) T28M probably damaging Het
Myh14 A G 7: 44,281,846 (GRCm39) V804A probably benign Het
Myo16 A G 8: 10,426,238 (GRCm39) I332V unknown Het
Ncor1 G T 11: 62,208,794 (GRCm39) Q1359K probably benign Het
Oog3 T C 4: 143,884,889 (GRCm39) D349G probably benign Het
Or12e1 A T 2: 87,022,594 (GRCm39) I188L probably benign Het
Or1j21 A G 2: 36,683,943 (GRCm39) K232E probably benign Het
Or52b4i A G 7: 102,191,830 (GRCm39) H229R probably benign Het
Or8k53 A G 2: 86,178,006 (GRCm39) Y35H possibly damaging Het
Pate4 A G 9: 35,519,595 (GRCm39) S32P possibly damaging Het
Pde1c G A 6: 56,103,910 (GRCm39) R580C probably damaging Het
Pi4ka C A 16: 17,111,841 (GRCm39) A1545S Het
Pign G T 1: 105,575,842 (GRCm39) T266K possibly damaging Het
Pitpnm2 A G 5: 124,260,090 (GRCm39) I1134T probably benign Het
Ppfia2 G A 10: 106,666,520 (GRCm39) V409I possibly damaging Het
Prr7 A G 13: 55,620,609 (GRCm39) T206A probably benign Het
Rnf13 A T 3: 57,727,955 (GRCm39) R212* probably null Het
Rwdd2b T C 16: 87,231,500 (GRCm39) N218S probably benign Het
Serpina3m A G 12: 104,355,834 (GRCm39) D167G possibly damaging Het
Slit2 A T 5: 48,142,547 (GRCm39) N56Y probably damaging Het
Sprr3 G T 3: 92,364,592 (GRCm39) T84K probably damaging Het
Stab2 A T 10: 86,709,766 (GRCm39) H1626Q possibly damaging Het
Tex2 C A 11: 106,437,721 (GRCm39) D650Y unknown Het
Tmprss6 A G 15: 78,330,926 (GRCm39) S436P probably benign Het
Uba2 A C 7: 33,864,860 (GRCm39) F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 (GRCm39) S242L probably damaging Het
Vmn1r86 T G 7: 12,836,685 (GRCm39) I64L probably benign Het
Vmn2r67 A T 7: 84,785,662 (GRCm39) V781E probably damaging Het
Vmn2r80 T A 10: 79,030,097 (GRCm39) F641Y probably damaging Het
Wdfy4 A T 14: 32,800,231 (GRCm39) I1965K Het
Wdr25 G A 12: 108,958,819 (GRCm39) G344S possibly damaging Het
Wdr90 G T 17: 26,073,083 (GRCm39) F837L probably benign Het
Xpo4 A G 14: 57,834,468 (GRCm39) V704A possibly damaging Het
Zc3h12d A G 10: 7,743,033 (GRCm39) K268E probably damaging Het
Other mutations in Pcdhb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Pcdhb7 APN 18 37,476,205 (GRCm39) missense probably benign 0.35
IGL01806:Pcdhb7 APN 18 37,475,548 (GRCm39) missense possibly damaging 0.60
IGL01862:Pcdhb7 APN 18 37,476,915 (GRCm39) missense possibly damaging 0.81
IGL01961:Pcdhb7 APN 18 37,475,526 (GRCm39) missense probably damaging 1.00
R0184:Pcdhb7 UTSW 18 37,476,443 (GRCm39) missense probably benign 0.44
R0426:Pcdhb7 UTSW 18 37,475,857 (GRCm39) missense probably damaging 0.99
R0576:Pcdhb7 UTSW 18 37,475,410 (GRCm39) missense probably benign 0.01
R0646:Pcdhb7 UTSW 18 37,476,442 (GRCm39) missense probably damaging 1.00
R0656:Pcdhb7 UTSW 18 37,474,954 (GRCm39) missense probably benign 0.01
R1216:Pcdhb7 UTSW 18 37,476,927 (GRCm39) missense probably damaging 0.99
R1851:Pcdhb7 UTSW 18 37,475,631 (GRCm39) missense possibly damaging 0.69
R2168:Pcdhb7 UTSW 18 37,476,335 (GRCm39) missense probably benign 0.05
R2312:Pcdhb7 UTSW 18 37,475,250 (GRCm39) missense probably benign
R3153:Pcdhb7 UTSW 18 37,476,126 (GRCm39) missense probably damaging 1.00
R3758:Pcdhb7 UTSW 18 37,476,079 (GRCm39) missense possibly damaging 0.84
R3763:Pcdhb7 UTSW 18 37,474,936 (GRCm39) missense probably benign
R3940:Pcdhb7 UTSW 18 37,477,021 (GRCm39) missense probably damaging 1.00
R3949:Pcdhb7 UTSW 18 37,476,141 (GRCm39) missense probably benign 0.00
R4418:Pcdhb7 UTSW 18 37,476,535 (GRCm39) missense probably benign 0.08
R4580:Pcdhb7 UTSW 18 37,475,188 (GRCm39) missense probably damaging 1.00
R4880:Pcdhb7 UTSW 18 37,475,284 (GRCm39) missense probably benign 0.00
R4936:Pcdhb7 UTSW 18 37,475,203 (GRCm39) missense probably damaging 1.00
R4936:Pcdhb7 UTSW 18 37,475,202 (GRCm39) nonsense probably null
R5086:Pcdhb7 UTSW 18 37,476,162 (GRCm39) missense possibly damaging 0.56
R5517:Pcdhb7 UTSW 18 37,474,846 (GRCm39) intron probably benign
R5570:Pcdhb7 UTSW 18 37,477,224 (GRCm39) missense probably benign 0.35
R5827:Pcdhb7 UTSW 18 37,475,077 (GRCm39) missense probably benign 0.14
R6187:Pcdhb7 UTSW 18 37,475,622 (GRCm39) missense probably benign 0.23
R6194:Pcdhb7 UTSW 18 37,475,199 (GRCm39) missense probably damaging 0.98
R6195:Pcdhb7 UTSW 18 37,475,709 (GRCm39) missense probably benign 0.33
R6373:Pcdhb7 UTSW 18 37,475,264 (GRCm39) nonsense probably null
R6398:Pcdhb7 UTSW 18 37,476,487 (GRCm39) missense possibly damaging 0.86
R6437:Pcdhb7 UTSW 18 37,475,743 (GRCm39) missense probably damaging 0.96
R6587:Pcdhb7 UTSW 18 37,477,156 (GRCm39) missense probably benign
R6596:Pcdhb7 UTSW 18 37,476,414 (GRCm39) missense probably damaging 0.97
R6646:Pcdhb7 UTSW 18 37,477,027 (GRCm39) missense possibly damaging 0.90
R6702:Pcdhb7 UTSW 18 37,474,959 (GRCm39) missense probably benign 0.03
R6923:Pcdhb7 UTSW 18 37,475,522 (GRCm39) splice site probably null
R6976:Pcdhb7 UTSW 18 37,476,631 (GRCm39) missense probably benign 0.12
R7038:Pcdhb7 UTSW 18 37,475,257 (GRCm39) missense possibly damaging 0.90
R7325:Pcdhb7 UTSW 18 37,476,440 (GRCm39) missense probably benign 0.00
R7509:Pcdhb7 UTSW 18 37,475,074 (GRCm39) missense possibly damaging 0.68
R7598:Pcdhb7 UTSW 18 37,475,833 (GRCm39) missense probably damaging 1.00
R7828:Pcdhb7 UTSW 18 37,476,915 (GRCm39) missense probably damaging 1.00
R9598:Pcdhb7 UTSW 18 37,475,434 (GRCm39) missense probably damaging 1.00
Z1177:Pcdhb7 UTSW 18 37,476,261 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCAGGTGACTCTTGAAAAGCC -3'
(R):5'- TCACAAACTCAGGAGCATTGTC -3'

Sequencing Primer
(F):5'- TGACTCTTGAAAAGCCAGTGC -3'
(R):5'- CATTGATGTCCATGATCAGGATTCG -3'
Posted On 2019-10-24