Incidental Mutation 'R0233:Slc17a3'
ID58923
Institutional Source Beutler Lab
Gene Symbol Slc17a3
Ensembl Gene ENSMUSG00000036083
Gene Namesolute carrier family 17 (sodium phosphate), member 3
SynonymsNpt4
MMRRC Submission 038474-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0233 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23839434-23860716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23855858 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 293 (S293F)
Ref Sequence ENSEMBL: ENSMUSP00000131308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039721] [ENSMUST00000091698] [ENSMUST00000110422] [ENSMUST00000166467]
Predicted Effect probably damaging
Transcript: ENSMUST00000039721
AA Change: S293F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039062
Gene: ENSMUSG00000036083
AA Change: S293F

DomainStartEndE-ValueType
Pfam:MFS_1 45 377 3.3e-46 PFAM
transmembrane domain 393 415 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 459 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091698
AA Change: S215F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089290
Gene: ENSMUSG00000036083
AA Change: S215F

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:MFS_1 95 293 2.8e-25 PFAM
transmembrane domain 310 332 N/A INTRINSIC
transmembrane domain 352 369 N/A INTRINSIC
transmembrane domain 379 398 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110422
AA Change: S257F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106052
Gene: ENSMUSG00000036083
AA Change: S257F

DomainStartEndE-ValueType
Pfam:MFS_1 39 425 6.7e-47 PFAM
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166467
AA Change: S293F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131308
Gene: ENSMUSG00000036083
AA Change: S293F

DomainStartEndE-ValueType
Pfam:MFS_1 9 338 2.3e-46 PFAM
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Meta Mutation Damage Score 0.8156 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a voltage-driven transporter that excretes intracellular urate and organic anions from the blood into renal tubule cells. Two transcript variants encoding different isoforms have been found for this gene. The longer isoform is a plasma membrane protein with transporter activity while the shorter isoform localizes to the endoplasmic reticulum. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,373 S212P probably benign Het
4932438A13Rik T A 3: 36,948,563 C1552* probably null Het
A730018C14Rik A C 12: 112,415,430 noncoding transcript Het
Acsf3 A G 8: 122,780,292 Y108C probably damaging Het
Acsl1 A G 8: 46,513,569 probably benign Het
Adad1 T A 3: 37,084,948 I389N possibly damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Ano5 T C 7: 51,535,470 F46S possibly damaging Het
Ap2a1 T C 7: 44,915,973 N114S probably damaging Het
Arap1 C T 7: 101,400,241 S970L possibly damaging Het
Atad3a A T 4: 155,746,067 S525T probably damaging Het
B4galnt1 T C 10: 127,170,911 probably benign Het
Cacna2d2 A T 9: 107,514,670 I463F probably damaging Het
Casp6 T A 3: 129,905,975 N34K probably damaging Het
Ccdc175 A T 12: 72,105,876 F752I probably benign Het
Cdhr4 A G 9: 107,996,934 I76V probably benign Het
Copa T C 1: 172,087,667 probably null Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
Cuzd1 C A 7: 131,311,816 K357N possibly damaging Het
Dnah5 T A 15: 28,333,070 F2206I probably damaging Het
Dnase2b T A 3: 146,582,550 K263N probably benign Het
Dync1h1 T A 12: 110,640,980 D2668E probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam124b T C 1: 80,212,986 S227G probably damaging Het
Fam13b T A 18: 34,448,084 Y675F probably damaging Het
Fgf21 T A 7: 45,615,297 M4L probably benign Het
Flg2 T A 3: 93,201,797 C377* probably null Het
Foxp2 T C 6: 15,409,753 S451P probably damaging Het
Gli2 A T 1: 118,835,925 S1499T probably damaging Het
Gm13078 A T 4: 143,726,063 E21D possibly damaging Het
Gm8909 A G 17: 36,167,469 Y224H probably benign Het
Gm9920 A T 15: 55,112,461 probably benign Het
Gpx5 T A 13: 21,287,403 D210V probably damaging Het
Hoxb5 T A 11: 96,305,027 S234T probably benign Het
Irf9 C A 14: 55,606,094 N140K probably benign Het
Isg20 C T 7: 78,914,495 T50M probably damaging Het
Isg20 C A 7: 78,916,586 D94E probably damaging Het
Izumo1 T C 7: 45,624,168 L115P probably damaging Het
Kdm3b G A 18: 34,809,420 E655K probably damaging Het
Kdm5b T G 1: 134,604,634 probably benign Het
Kifc3 A G 8: 95,101,472 probably null Het
Kpna2 T C 11: 106,992,631 S111G probably benign Het
Krt73 A T 15: 101,802,016 N94K probably benign Het
Lgmn G T 12: 102,399,989 D247E probably damaging Het
Lilra6 C T 7: 3,914,936 V70I possibly damaging Het
Lrig3 G A 10: 126,013,526 probably null Het
Lrrc4 T C 6: 28,829,735 H627R probably benign Het
Macf1 G A 4: 123,450,127 probably benign Het
Nat9 C A 11: 115,183,408 probably null Het
Nutm2 A G 13: 50,467,405 D2G probably benign Het
Olfr1151 A G 2: 87,857,752 I192M probably benign Het
Olfr1404 A T 1: 173,216,301 I217F probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Parl G A 16: 20,287,907 P184L probably damaging Het
Pdzd8 A T 19: 59,300,379 M863K probably damaging Het
Phlda3 T C 1: 135,766,821 S125P probably damaging Het
Pkd1l3 A T 8: 109,650,780 R217* probably null Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Prg4 T C 1: 150,453,547 probably benign Het
Prkab1 A G 5: 116,021,652 probably benign Het
Pyroxd1 A G 6: 142,354,630 E162G possibly damaging Het
R3hcc1l G A 19: 42,582,921 probably null Het
Rgs12 T A 5: 35,030,498 S500T probably damaging Het
Ripor3 T C 2: 167,992,598 D299G probably damaging Het
Robo4 T C 9: 37,402,681 L76P probably damaging Het
Sbno1 T C 5: 124,376,226 Y1302C probably damaging Het
Sec63 A G 10: 42,823,908 I655V possibly damaging Het
Serpina11 T A 12: 103,980,470 M389L probably benign Het
Sfswap C A 5: 129,554,543 P745Q possibly damaging Het
Slitrk3 C T 3: 73,048,577 S954N probably benign Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Sos2 A T 12: 69,617,330 I460N probably benign Het
Spink7 T A 18: 62,594,352 I34L probably benign Het
Srbd1 A G 17: 86,057,745 S628P probably damaging Het
Srm G A 4: 148,593,372 G156S probably damaging Het
Sulf2 T C 2: 166,085,669 probably benign Het
Tmc4 T A 7: 3,666,867 Y6F probably benign Het
Tmcc2 A G 1: 132,360,651 F433L probably damaging Het
Tmprss13 T G 9: 45,337,100 probably benign Het
Tnxb T C 17: 34,699,033 F2307L probably benign Het
Tsr3 A G 17: 25,242,510 E274G probably benign Het
Ttn T C 2: 76,895,144 probably benign Het
Tub T C 7: 109,029,341 V352A possibly damaging Het
Tubb2a A G 13: 34,075,342 I155T possibly damaging Het
Ugt2a2 T C 5: 87,475,001 N36S probably damaging Het
Usp13 T A 3: 32,915,664 probably null Het
Vmn1r52 T G 6: 90,179,611 L120R possibly damaging Het
Vmn2r11 A T 5: 109,054,102 S179T probably benign Het
Vwf A T 6: 125,686,510 R2805W possibly damaging Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp286 T C 11: 62,780,393 T285A possibly damaging Het
Other mutations in Slc17a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Slc17a3 APN 13 23856481 missense probably benign 0.20
IGL02569:Slc17a3 APN 13 23846302 missense probably damaging 1.00
IGL02628:Slc17a3 APN 13 23842451 start codon destroyed probably null 1.00
IGL02745:Slc17a3 APN 13 23842486 missense probably benign 0.01
IGL03001:Slc17a3 APN 13 23856784 missense probably damaging 1.00
IGL03143:Slc17a3 APN 13 23855979 splice site probably null
IGL03144:Slc17a3 APN 13 23846440 missense probably benign 0.00
R0052:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0054:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0131:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0131:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0152:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0153:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0234:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0257:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0294:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0295:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0318:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0319:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0352:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0462:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0610:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0627:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0652:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0765:Slc17a3 UTSW 13 23846896 nonsense probably null
R1529:Slc17a3 UTSW 13 23845445 missense probably damaging 1.00
R1532:Slc17a3 UTSW 13 23856500 missense probably damaging 1.00
R1569:Slc17a3 UTSW 13 23855608 missense probably benign 0.09
R1640:Slc17a3 UTSW 13 23852357 nonsense probably null
R1643:Slc17a3 UTSW 13 23857198 splice site probably benign
R1715:Slc17a3 UTSW 13 23856741 missense probably benign 0.19
R2407:Slc17a3 UTSW 13 23852435 critical splice donor site probably null
R2512:Slc17a3 UTSW 13 23846247 missense probably benign 0.13
R3923:Slc17a3 UTSW 13 23858054 missense possibly damaging 0.89
R4449:Slc17a3 UTSW 13 23856732 missense probably damaging 0.99
R5166:Slc17a3 UTSW 13 23842542 critical splice donor site probably null
R5748:Slc17a3 UTSW 13 23856466 missense probably damaging 1.00
R5989:Slc17a3 UTSW 13 23842428 start gained probably benign
R6281:Slc17a3 UTSW 13 23856799 missense probably benign 0.17
R6811:Slc17a3 UTSW 13 23855941 missense possibly damaging 0.61
R7283:Slc17a3 UTSW 13 23855848 missense
R7341:Slc17a3 UTSW 13 23846884 nonsense probably null
R7467:Slc17a3 UTSW 13 23846967 critical splice donor site probably null
R7485:Slc17a3 UTSW 13 23855849 missense
R8065:Slc17a3 UTSW 13 23858087 missense unknown
Predicted Primers PCR Primer
(F):5'- TGATTTATGATGACCCTGTCTCTCACCC -3'
(R):5'- ACTGTGACAGATGATGCAAACATGAAGA -3'

Sequencing Primer
(F):5'- TCTCTGAACCAACAGGTACATATAAG -3'
(R):5'- TGATGCAAACATGAAGAAGGAATG -3'
Posted On2013-07-11