Incidental Mutation 'R7623:Cnot1'
ID589257
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7623 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95727648 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 2067 (F2067I)
Ref Sequence ENSEMBL: ENSMUSP00000063565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]
Predicted Effect probably damaging
Transcript: ENSMUST00000068452
AA Change: F2067I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: F2067I

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098473
AA Change: F2072I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: F2072I

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211887
AA Change: F2065I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000212415
Predicted Effect probably benign
Transcript: ENSMUST00000213006
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik G T 16: 21,694,342 L22M probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
Abca9 T C 11: 110,107,558 N1468S probably benign Het
Abcc5 C T 16: 20,344,696 D1264N possibly damaging Het
Acadvl G T 11: 70,010,743 A570E probably damaging Het
Adgrb3 T A 1: 25,547,548 S355C probably damaging Het
Adgrv1 A G 13: 81,422,225 V4953A possibly damaging Het
Ano2 T A 6: 126,015,573 Y836* probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc8 T A 7: 16,996,612 D675E possibly damaging Het
Ccnb2 A G 9: 70,418,888 V58A probably benign Het
Cdh24 A T 14: 54,638,090 Y296N probably damaging Het
Cfap46 T C 7: 139,618,350 E2054G unknown Het
Csmd3 A G 15: 47,949,938 F329S Het
Dact3 C A 7: 16,885,915 T445K unknown Het
Dph6 C A 2: 114,654,898 probably benign Het
Dst T A 1: 34,170,436 C1195S probably damaging Het
Fam102a A G 2: 32,566,334 D336G possibly damaging Het
Fat3 T A 9: 15,988,324 N3138Y probably damaging Het
Fbxw25 T C 9: 109,654,583 N187S Het
Fuca1 A G 4: 135,933,094 I308V probably benign Het
Galnt5 A G 2: 58,017,210 R562G probably damaging Het
Gas8 G T 8: 123,522,979 R44S probably damaging Het
Gja5 T C 3: 97,050,755 S43P possibly damaging Het
Gm14403 A G 2: 177,508,612 D117G probably benign Het
Gmpr2 G A 14: 55,673,034 V58M probably damaging Het
Gtpbp6 T A 5: 110,105,084 I301F probably damaging Het
Hdhd5 T C 6: 120,521,251 Y129C probably damaging Het
Hemgn A G 4: 46,396,504 M244T probably benign Het
Hist1h2bp T A 13: 21,787,592 D26E probably benign Het
Iglc1 T A 16: 19,061,801 H90L Het
Lamb2 C T 9: 108,489,224 S1545F possibly damaging Het
Mc4r T C 18: 66,859,509 T178A probably benign Het
Mcam T A 9: 44,139,658 S346T probably benign Het
Mis18bp1 A G 12: 65,148,852 S713P probably benign Het
Mybl2 A G 2: 163,072,832 Y290C probably damaging Het
Olfr1294 T C 2: 111,537,936 M118V probably damaging Het
Olfr859 A T 9: 19,808,929 I204F possibly damaging Het
Pak6 A G 2: 118,694,587 T565A probably damaging Het
Pde5a A G 3: 122,774,601 T284A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pkd1l2 A T 8: 117,029,645 F1616Y probably damaging Het
Pp2d1 T C 17: 53,515,879 E53G probably benign Het
Ppp3cc A C 14: 70,240,945 S269R probably benign Het
Ptprb A C 10: 116,369,309 D1856A possibly damaging Het
Rgs22 A T 15: 36,040,710 V1001E probably benign Het
Rnf8 T A 17: 29,629,006 V344E probably benign Het
Rpn1 T C 6: 88,084,568 L13P possibly damaging Het
Rsbn1 A T 3: 103,915,010 H187L probably benign Het
Sdr16c6 T A 4: 4,058,801 I262F not run Het
Sec22a A G 16: 35,329,524 F211L probably benign Het
Slc16a4 G A 3: 107,297,981 A42T possibly damaging Het
Smap1 T A 1: 23,848,295 Q386L probably benign Het
Sos1 A T 17: 80,479,894 F10L probably benign Het
Sptbn2 A G 19: 4,726,168 T202A probably damaging Het
Stab1 C A 14: 31,140,621 V2282L probably benign Het
Tmprss11f C T 5: 86,524,160 G391D probably damaging Het
Tnfaip2 A G 12: 111,445,638 S158G probably damaging Het
Trav6d-5 A G 14: 52,795,386 T31A probably benign Het
Tst G A 15: 78,405,703 A44V probably damaging Het
Vmn1r210 A T 13: 22,827,235 F294I probably benign Het
Vwc2 T C 11: 11,116,415 F168L probably damaging Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfp605 A G 5: 110,127,520 Y168C probably benign Het
Zfp790 T A 7: 29,825,705 Y49* probably null Het
Zfp93 T C 7: 24,276,369 F593S probably damaging Het
Zfr C T 15: 12,160,528 T729I possibly damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
barge UTSW 8 95734129 missense probably benign 0.13
kowloon UTSW 8 95788658 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7940:Cnot1 UTSW 8 95745647 frame shift probably null
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCCAGTGAGATTGTAGCAAATGG -3'
(R):5'- CATTTTGCTAGGATCCAATCTAGG -3'

Sequencing Primer
(F):5'- GAGTGCCACTAGAGTATCCTTAAGTC -3'
(R):5'- GATCCAATCTAGGAGAGGCCCTC -3'
Posted On2019-10-24