Incidental Mutation 'R7623:Olfr859'
ID589261
Institutional Source Beutler Lab
Gene Symbol Olfr859
Ensembl Gene ENSMUSG00000095448
Gene Nameolfactory receptor 859
SynonymsMOR146-3, GA_x6K02T2PVTD-13548326-13549255, MOR146-10_p
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7623 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location19804906-19817626 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19808929 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 204 (I204F)
Ref Sequence ENSEMBL: ENSMUSP00000148298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086480] [ENSMUST00000212540] [ENSMUST00000217280]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086480
AA Change: I204F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083669
Gene: ENSMUSG00000095448
AA Change: I204F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2e-7 PFAM
Pfam:7tm_1 41 290 3.9e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212540
AA Change: I204F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217280
AA Change: I204F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik G T 16: 21,694,342 L22M probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5430419D17Rik T A 7: 131,277,566 probably null Het
Abca9 T C 11: 110,107,558 N1468S probably benign Het
Abcc5 C T 16: 20,344,696 D1264N possibly damaging Het
Abhd10 A G 16: 45,732,736 probably benign Het
Acadvl G T 11: 70,010,743 A570E probably damaging Het
Adgrb3 T A 1: 25,547,548 S355C probably damaging Het
Adgrv1 A G 13: 81,422,225 V4953A possibly damaging Het
Ano2 T A 6: 126,015,573 Y836* probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc8 T A 7: 16,996,612 D675E possibly damaging Het
Ccnb2 A G 9: 70,418,888 V58A probably benign Het
Cdh24 A T 14: 54,638,090 Y296N probably damaging Het
Cfap46 T C 7: 139,618,350 E2054G unknown Het
Cnot1 A T 8: 95,727,648 F2067I probably damaging Het
Csmd3 A G 15: 47,949,938 F329S Het
Dact3 C A 7: 16,885,915 T445K unknown Het
Dph6 C A 2: 114,654,898 probably benign Het
Dst T A 1: 34,170,436 C1195S probably damaging Het
Fam102a A G 2: 32,566,334 D336G possibly damaging Het
Fat3 T A 9: 15,988,324 N3138Y probably damaging Het
Fbxw25 T C 9: 109,654,583 N187S Het
Fuca1 A G 4: 135,933,094 I308V probably benign Het
Galnt5 A G 2: 58,017,210 R562G probably damaging Het
Gas8 G T 8: 123,522,979 R44S probably damaging Het
Gja5 T C 3: 97,050,755 S43P possibly damaging Het
Gm14403 A G 2: 177,508,612 D117G probably benign Het
Gmpr2 G A 14: 55,673,034 V58M probably damaging Het
Gtpbp6 T A 5: 110,105,084 I301F probably damaging Het
Hdhd5 T C 6: 120,521,251 Y129C probably damaging Het
Hemgn A G 4: 46,396,504 M244T probably benign Het
Hist1h2bp T A 13: 21,787,592 D26E probably benign Het
Hoxa1 T G 6: 52,158,258 probably null Het
Iglc1 T A 16: 19,061,801 H90L Het
Lamb2 C T 9: 108,489,224 S1545F possibly damaging Het
Mc4r T C 18: 66,859,509 T178A probably benign Het
Mcam T A 9: 44,139,658 S346T probably benign Het
Mis18bp1 A G 12: 65,148,852 S713P probably benign Het
Mybl2 A G 2: 163,072,832 Y290C probably damaging Het
Olfr1294 T C 2: 111,537,936 M118V probably damaging Het
Pak6 A G 2: 118,694,587 T565A probably damaging Het
Pde5a A G 3: 122,774,601 T284A probably benign Het
Pkd1l2 A T 8: 117,029,645 F1616Y probably damaging Het
Pp2d1 T C 17: 53,515,879 E53G probably benign Het
Ppp3cc A C 14: 70,240,945 S269R probably benign Het
Ptprb A C 10: 116,369,309 D1856A possibly damaging Het
Rgs22 A T 15: 36,040,710 V1001E probably benign Het
Rnf8 T A 17: 29,629,006 V344E probably benign Het
Rpn1 T C 6: 88,084,568 L13P possibly damaging Het
Rsbn1 A T 3: 103,915,010 H187L probably benign Het
Sdr16c6 T A 4: 4,058,801 I262F not run Het
Sec22a A G 16: 35,329,524 F211L probably benign Het
Slc16a4 G A 3: 107,297,981 A42T possibly damaging Het
Smap1 T A 1: 23,848,295 Q386L probably benign Het
Sos1 A T 17: 80,479,894 F10L probably benign Het
Sptbn2 A G 19: 4,726,168 T202A probably damaging Het
Stab1 C A 14: 31,140,621 V2282L probably benign Het
Tmprss11f C T 5: 86,524,160 G391D probably damaging Het
Tnfaip2 A G 12: 111,445,638 S158G probably damaging Het
Trav6d-5 A G 14: 52,795,386 T31A probably benign Het
Tst G A 15: 78,405,703 A44V probably damaging Het
Vmn1r210 A T 13: 22,827,235 F294I probably benign Het
Vwc2 T C 11: 11,116,415 F168L probably damaging Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfp605 A G 5: 110,127,520 Y168C probably benign Het
Zfp790 T A 7: 29,825,705 Y49* probably null Het
Zfp93 T C 7: 24,276,369 F593S probably damaging Het
Zfr C T 15: 12,160,528 T729I possibly damaging Het
Other mutations in Olfr859
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Olfr859 APN 9 19808396 missense probably benign 0.09
IGL00897:Olfr859 APN 9 19808621 missense probably damaging 0.97
IGL01132:Olfr859 APN 9 19808654 missense probably damaging 0.97
IGL01768:Olfr859 APN 9 19809160 missense possibly damaging 0.57
IGL02302:Olfr859 APN 9 19808685 missense probably damaging 0.97
IGL02377:Olfr859 APN 9 19809047 missense probably damaging 0.99
IGL02972:Olfr859 APN 9 19808942 missense probably damaging 0.97
R0139:Olfr859 UTSW 9 19808869 missense probably damaging 0.99
R0367:Olfr859 UTSW 9 19808543 missense probably damaging 0.99
R0521:Olfr859 UTSW 9 19808860 missense probably benign 0.00
R1196:Olfr859 UTSW 9 19808632 missense probably benign 0.00
R3742:Olfr859 UTSW 9 19808899 missense probably benign 0.44
R5567:Olfr859 UTSW 9 19808378 missense probably damaging 0.99
R6499:Olfr859 UTSW 9 19808551 missense probably benign
R6501:Olfr859 UTSW 9 19808975 missense possibly damaging 0.95
R6560:Olfr859 UTSW 9 19809116 missense probably benign
R7291:Olfr859 UTSW 9 19808648 missense possibly damaging 0.71
R7627:Olfr859 UTSW 9 19808651 missense probably damaging 0.99
Z1177:Olfr859 UTSW 9 19808534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTCTGAATCCTTGTCGGTG -3'
(R):5'- GCCACCATACTTTCCTTGGAAG -3'

Sequencing Primer
(F):5'- AATCCTTGTCGGTGTAGATATTTGG -3'
(R):5'- ACTGTTGAACTGAGGTAGACTCC -3'
Posted On2019-10-24