Incidental Mutation 'R0233:Dnah5'
ID 58928
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Name dynein, axonemal, heavy chain 5
Synonyms Dnahc5, b2b3491Clo, b2b1154Clo, b2b1134Clo, b2b1565Clo, b2b1537Clo, Mdnah5
MMRRC Submission 038474-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.812) question?
Stock # R0233 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 28203898-28472198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28333216 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 2206 (F2206I)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000067048
AA Change: F2206I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: F2206I

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Meta Mutation Damage Score 0.7413 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,385,330 (GRCm39) S212P probably benign Het
A730018C14Rik A C 12: 112,381,864 (GRCm39) noncoding transcript Het
Acsf3 A G 8: 123,507,031 (GRCm39) Y108C probably damaging Het
Acsl1 A G 8: 46,966,606 (GRCm39) probably benign Het
Adad1 T A 3: 37,139,097 (GRCm39) I389N possibly damaging Het
Ankrd27 T C 7: 35,300,985 (GRCm39) L95P probably damaging Het
Ano5 T C 7: 51,185,218 (GRCm39) F46S possibly damaging Het
Ap2a1 T C 7: 44,565,397 (GRCm39) N114S probably damaging Het
Arap1 C T 7: 101,049,448 (GRCm39) S970L possibly damaging Het
Atad3a A T 4: 155,830,524 (GRCm39) S525T probably damaging Het
B4galnt1 T C 10: 127,006,780 (GRCm39) probably benign Het
Bltp1 T A 3: 37,002,712 (GRCm39) C1552* probably null Het
Cacna2d2 A T 9: 107,391,869 (GRCm39) I463F probably damaging Het
Casp6 T A 3: 129,699,624 (GRCm39) N34K probably damaging Het
Ccdc175 A T 12: 72,152,650 (GRCm39) F752I probably benign Het
Cdhr4 A G 9: 107,874,133 (GRCm39) I76V probably benign Het
Copa T C 1: 171,915,234 (GRCm39) probably null Het
Cox11 C T 11: 90,535,326 (GRCm39) T259I probably damaging Het
Cuzd1 C A 7: 130,913,545 (GRCm39) K357N possibly damaging Het
Dnase2b T A 3: 146,288,305 (GRCm39) K263N probably benign Het
Dync1h1 T A 12: 110,607,414 (GRCm39) D2668E probably benign Het
Eno1b T C 18: 48,180,806 (GRCm39) I328T probably benign Het
Fam124b T C 1: 80,190,703 (GRCm39) S227G probably damaging Het
Fam13b T A 18: 34,581,137 (GRCm39) Y675F probably damaging Het
Fgf21 T A 7: 45,264,721 (GRCm39) M4L probably benign Het
Flg2 T A 3: 93,109,104 (GRCm39) C377* probably null Het
Foxp2 T C 6: 15,409,752 (GRCm39) S451P probably damaging Het
Gli2 A T 1: 118,763,655 (GRCm39) S1499T probably damaging Het
Gm9920 A T 15: 54,975,857 (GRCm39) probably benign Het
Gpx5 T A 13: 21,471,573 (GRCm39) D210V probably damaging Het
H2-T5 A G 17: 36,478,361 (GRCm39) Y224H probably benign Het
Hoxb5 T A 11: 96,195,853 (GRCm39) S234T probably benign Het
Irf9 C A 14: 55,843,551 (GRCm39) N140K probably benign Het
Isg20 C A 7: 78,566,334 (GRCm39) D94E probably damaging Het
Isg20 C T 7: 78,564,243 (GRCm39) T50M probably damaging Het
Izumo1 T C 7: 45,273,592 (GRCm39) L115P probably damaging Het
Kdm3b G A 18: 34,942,473 (GRCm39) E655K probably damaging Het
Kdm5b T G 1: 134,532,372 (GRCm39) probably benign Het
Kifc3 A G 8: 95,828,100 (GRCm39) probably null Het
Kpna2 T C 11: 106,883,457 (GRCm39) S111G probably benign Het
Krt73 A T 15: 101,710,451 (GRCm39) N94K probably benign Het
Lgmn G T 12: 102,366,248 (GRCm39) D247E probably damaging Het
Lilra6 C T 7: 3,917,935 (GRCm39) V70I possibly damaging Het
Lrig3 G A 10: 125,849,395 (GRCm39) probably null Het
Lrrc4 T C 6: 28,829,734 (GRCm39) H627R probably benign Het
Macf1 G A 4: 123,343,920 (GRCm39) probably benign Het
Nat9 C A 11: 115,074,234 (GRCm39) probably null Het
Nutm2 A G 13: 50,621,441 (GRCm39) D2G probably benign Het
Or10j3b A T 1: 173,043,868 (GRCm39) I217F probably benign Het
Or5h23 A T 16: 58,906,038 (GRCm39) D269E probably benign Het
Or5w8 A G 2: 87,688,096 (GRCm39) I192M probably benign Het
Parl G A 16: 20,106,657 (GRCm39) P184L probably damaging Het
Pdzd8 A T 19: 59,288,811 (GRCm39) M863K probably damaging Het
Phlda3 T C 1: 135,694,559 (GRCm39) S125P probably damaging Het
Pkd1l3 A T 8: 110,377,412 (GRCm39) R217* probably null Het
Plekhg5 T C 4: 152,196,676 (GRCm39) C695R probably damaging Het
Pramel24 A T 4: 143,452,633 (GRCm39) E21D possibly damaging Het
Prg4 T C 1: 150,329,298 (GRCm39) probably benign Het
Prkab1 A G 5: 116,159,711 (GRCm39) probably benign Het
Pyroxd1 A G 6: 142,300,356 (GRCm39) E162G possibly damaging Het
R3hcc1l G A 19: 42,571,360 (GRCm39) probably null Het
Rgs12 T A 5: 35,187,842 (GRCm39) S500T probably damaging Het
Ripor3 T C 2: 167,834,518 (GRCm39) D299G probably damaging Het
Robo4 T C 9: 37,313,977 (GRCm39) L76P probably damaging Het
Sbno1 T C 5: 124,514,289 (GRCm39) Y1302C probably damaging Het
Sec63 A G 10: 42,699,904 (GRCm39) I655V possibly damaging Het
Serpina11 T A 12: 103,946,729 (GRCm39) M389L probably benign Het
Sfswap C A 5: 129,631,607 (GRCm39) P745Q possibly damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slitrk3 C T 3: 72,955,910 (GRCm39) S954N probably benign Het
Sorbs2 A G 8: 46,222,866 (GRCm39) T190A probably damaging Het
Sos2 A T 12: 69,664,104 (GRCm39) I460N probably benign Het
Spink7 T A 18: 62,727,423 (GRCm39) I34L probably benign Het
Srbd1 A G 17: 86,365,173 (GRCm39) S628P probably damaging Het
Srm G A 4: 148,677,829 (GRCm39) G156S probably damaging Het
Sulf2 T C 2: 165,927,589 (GRCm39) probably benign Het
Tmc4 T A 7: 3,669,866 (GRCm39) Y6F probably benign Het
Tmcc2 A G 1: 132,288,389 (GRCm39) F433L probably damaging Het
Tmprss13 T G 9: 45,248,398 (GRCm39) probably benign Het
Tnxb T C 17: 34,918,007 (GRCm39) F2307L probably benign Het
Tsr3 A G 17: 25,461,484 (GRCm39) E274G probably benign Het
Ttn T C 2: 76,725,488 (GRCm39) probably benign Het
Tub T C 7: 108,628,548 (GRCm39) V352A possibly damaging Het
Tubb2a A G 13: 34,259,325 (GRCm39) I155T possibly damaging Het
Ugt2a2 T C 5: 87,622,860 (GRCm39) N36S probably damaging Het
Usp13 T A 3: 32,969,813 (GRCm39) probably null Het
Vmn1r52 T G 6: 90,156,593 (GRCm39) L120R possibly damaging Het
Vmn2r11 A T 5: 109,201,968 (GRCm39) S179T probably benign Het
Vwf A T 6: 125,663,473 (GRCm39) R2805W possibly damaging Het
Wdr7 A G 18: 64,037,172 (GRCm39) T1199A probably benign Het
Zfp286 T C 11: 62,671,219 (GRCm39) T285A possibly damaging Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28,272,488 (GRCm39) missense probably benign
IGL00331:Dnah5 APN 15 28,421,766 (GRCm39) missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28,444,364 (GRCm39) missense probably benign 0.10
IGL00537:Dnah5 APN 15 28,458,848 (GRCm39) critical splice donor site probably null
IGL01102:Dnah5 APN 15 28,410,149 (GRCm39) critical splice donor site probably null
IGL01126:Dnah5 APN 15 28,302,545 (GRCm39) missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28,458,802 (GRCm39) missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28,295,059 (GRCm39) splice site probably benign
IGL01353:Dnah5 APN 15 28,233,418 (GRCm39) missense probably benign 0.00
IGL01372:Dnah5 APN 15 28,230,636 (GRCm39) missense probably benign 0.00
IGL01390:Dnah5 APN 15 28,411,686 (GRCm39) missense probably benign 0.00
IGL01446:Dnah5 APN 15 28,326,815 (GRCm39) missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28,331,872 (GRCm39) missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28,331,872 (GRCm39) missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28,229,798 (GRCm39) missense probably benign 0.01
IGL01592:Dnah5 APN 15 28,236,783 (GRCm39) missense probably benign 0.01
IGL01594:Dnah5 APN 15 28,311,480 (GRCm39) missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28,367,928 (GRCm39) missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28,449,315 (GRCm39) missense probably benign 0.06
IGL01904:Dnah5 APN 15 28,307,510 (GRCm39) missense probably benign 0.09
IGL01913:Dnah5 APN 15 28,313,899 (GRCm39) missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28,290,435 (GRCm39) missense probably null 1.00
IGL01963:Dnah5 APN 15 28,370,682 (GRCm39) missense probably benign 0.12
IGL02008:Dnah5 APN 15 28,343,698 (GRCm39) missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28,459,264 (GRCm39) critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28,240,187 (GRCm39) splice site probably benign
IGL02114:Dnah5 APN 15 28,397,270 (GRCm39) missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28,248,031 (GRCm39) missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28,299,386 (GRCm39) missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28,340,527 (GRCm39) missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28,219,296 (GRCm39) missense probably benign 0.09
IGL02626:Dnah5 APN 15 28,307,422 (GRCm39) missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28,289,193 (GRCm39) splice site probably benign
IGL02651:Dnah5 APN 15 28,350,768 (GRCm39) missense probably benign 0.05
IGL02652:Dnah5 APN 15 28,366,333 (GRCm39) missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28,409,442 (GRCm39) missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28,445,289 (GRCm39) missense probably benign 0.00
IGL02721:Dnah5 APN 15 28,234,389 (GRCm39) critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28,453,358 (GRCm39) missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28,383,771 (GRCm39) missense probably benign 0.01
IGL02945:Dnah5 APN 15 28,270,572 (GRCm39) missense probably benign 0.00
IGL02949:Dnah5 APN 15 28,272,331 (GRCm39) missense probably benign 0.32
IGL02971:Dnah5 APN 15 28,384,607 (GRCm39) missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28,340,471 (GRCm39) missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28,295,545 (GRCm39) missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28,290,309 (GRCm39) missense probably benign 0.08
IGL03224:Dnah5 APN 15 28,459,300 (GRCm39) missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28,311,294 (GRCm39) missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28,458,795 (GRCm39) missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28,233,441 (GRCm39) critical splice donor site probably null
IGL03331:Dnah5 APN 15 28,420,086 (GRCm39) missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28,290,287 (GRCm39) missense probably benign 0.10
IGL03367:Dnah5 APN 15 28,234,473 (GRCm39) missense possibly damaging 0.95
Firtel UTSW 15 28,448,513 (GRCm39) missense possibly damaging 0.95
lowbar UTSW 15 28,311,279 (GRCm39) splice site probably null
notherone UTSW 15 28,340,552 (GRCm39) missense probably benign 0.13
scheffler UTSW 15 28,438,237 (GRCm39) splice site probably benign
IGL02837:Dnah5 UTSW 15 28,269,546 (GRCm39) missense probably benign
P0008:Dnah5 UTSW 15 28,302,533 (GRCm39) missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28,403,619 (GRCm39) missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28,383,723 (GRCm39) missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28,451,663 (GRCm39) missense probably benign 0.34
R0087:Dnah5 UTSW 15 28,350,759 (GRCm39) missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28,240,080 (GRCm39) missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28,245,897 (GRCm39) splice site probably benign
R0102:Dnah5 UTSW 15 28,245,897 (GRCm39) splice site probably benign
R0104:Dnah5 UTSW 15 28,453,499 (GRCm39) missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28,263,825 (GRCm39) missense probably benign 0.00
R0122:Dnah5 UTSW 15 28,378,509 (GRCm39) missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28,246,465 (GRCm39) missense probably benign 0.00
R0127:Dnah5 UTSW 15 28,295,071 (GRCm39) missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28,299,256 (GRCm39) missense probably benign 0.19
R0386:Dnah5 UTSW 15 28,383,727 (GRCm39) missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28,229,687 (GRCm39) missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28,383,745 (GRCm39) missense probably benign 0.31
R0514:Dnah5 UTSW 15 28,366,467 (GRCm39) missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28,327,925 (GRCm39) missense probably benign
R0720:Dnah5 UTSW 15 28,314,007 (GRCm39) missense probably null 0.98
R0731:Dnah5 UTSW 15 28,311,289 (GRCm39) missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28,444,333 (GRCm39) missense possibly damaging 0.64
R0747:Dnah5 UTSW 15 28,444,332 (GRCm39) missense probably damaging 0.99
R0766:Dnah5 UTSW 15 28,448,633 (GRCm39) missense probably null 0.89
R0849:Dnah5 UTSW 15 28,263,745 (GRCm39) missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28,302,617 (GRCm39) missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28,343,598 (GRCm39) missense probably benign 0.01
R1148:Dnah5 UTSW 15 28,421,836 (GRCm39) missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28,421,836 (GRCm39) missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28,246,403 (GRCm39) missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28,327,877 (GRCm39) missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28,327,877 (GRCm39) missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28,238,657 (GRCm39) missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28,314,064 (GRCm39) splice site probably benign
R1401:Dnah5 UTSW 15 28,402,059 (GRCm39) missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28,370,555 (GRCm39) missense probably benign
R1430:Dnah5 UTSW 15 28,346,003 (GRCm39) missense probably benign 0.37
R1457:Dnah5 UTSW 15 28,403,688 (GRCm39) critical splice donor site probably null
R1468:Dnah5 UTSW 15 28,230,609 (GRCm39) nonsense probably null
R1468:Dnah5 UTSW 15 28,230,609 (GRCm39) nonsense probably null
R1560:Dnah5 UTSW 15 28,420,149 (GRCm39) missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28,409,323 (GRCm39) missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28,252,569 (GRCm39) missense probably benign 0.00
R1574:Dnah5 UTSW 15 28,252,569 (GRCm39) missense probably benign 0.00
R1603:Dnah5 UTSW 15 28,449,326 (GRCm39) missense probably benign 0.09
R1603:Dnah5 UTSW 15 28,295,131 (GRCm39) splice site probably benign
R1673:Dnah5 UTSW 15 28,290,294 (GRCm39) missense probably benign
R1755:Dnah5 UTSW 15 28,326,782 (GRCm39) missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28,313,932 (GRCm39) missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28,313,932 (GRCm39) missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28,270,572 (GRCm39) missense probably benign 0.00
R1817:Dnah5 UTSW 15 28,246,546 (GRCm39) nonsense probably null
R1819:Dnah5 UTSW 15 28,246,546 (GRCm39) nonsense probably null
R1834:Dnah5 UTSW 15 28,409,270 (GRCm39) missense probably benign 0.00
R1855:Dnah5 UTSW 15 28,411,815 (GRCm39) missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28,331,859 (GRCm39) nonsense probably null
R1871:Dnah5 UTSW 15 28,331,859 (GRCm39) nonsense probably null
R1987:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28,366,416 (GRCm39) missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28,312,534 (GRCm39) splice site probably null
R2121:Dnah5 UTSW 15 28,297,151 (GRCm39) splice site probably benign
R2128:Dnah5 UTSW 15 28,408,467 (GRCm39) missense probably benign 0.00
R2129:Dnah5 UTSW 15 28,408,467 (GRCm39) missense probably benign 0.00
R2151:Dnah5 UTSW 15 28,444,237 (GRCm39) missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28,252,691 (GRCm39) missense probably benign 0.00
R2207:Dnah5 UTSW 15 28,343,817 (GRCm39) missense probably benign 0.11
R2231:Dnah5 UTSW 15 28,408,563 (GRCm39) critical splice donor site probably null
R2232:Dnah5 UTSW 15 28,408,563 (GRCm39) critical splice donor site probably null
R2282:Dnah5 UTSW 15 28,327,448 (GRCm39) missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28,387,913 (GRCm39) missense probably benign 0.25
R2339:Dnah5 UTSW 15 28,314,028 (GRCm39) missense probably benign 0.00
R2437:Dnah5 UTSW 15 28,307,537 (GRCm39) critical splice donor site probably null
R2696:Dnah5 UTSW 15 28,278,722 (GRCm39) missense probably benign 0.00
R3156:Dnah5 UTSW 15 28,438,237 (GRCm39) splice site probably benign
R3431:Dnah5 UTSW 15 28,295,413 (GRCm39) missense probably benign 0.20
R3700:Dnah5 UTSW 15 28,387,937 (GRCm39) missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28,270,566 (GRCm39) missense probably benign 0.08
R3732:Dnah5 UTSW 15 28,409,268 (GRCm39) missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28,411,656 (GRCm39) missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28,421,144 (GRCm39) missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28,340,444 (GRCm39) nonsense probably null
R4075:Dnah5 UTSW 15 28,293,937 (GRCm39) missense probably benign
R4245:Dnah5 UTSW 15 28,219,335 (GRCm39) missense probably benign
R4254:Dnah5 UTSW 15 28,438,248 (GRCm39) missense probably benign 0.07
R4255:Dnah5 UTSW 15 28,438,248 (GRCm39) missense probably benign 0.07
R4392:Dnah5 UTSW 15 28,289,375 (GRCm39) missense probably benign 0.19
R4552:Dnah5 UTSW 15 28,397,300 (GRCm39) missense probably benign 0.19
R4574:Dnah5 UTSW 15 28,367,909 (GRCm39) missense probably benign 0.05
R4577:Dnah5 UTSW 15 28,289,396 (GRCm39) missense probably benign 0.06
R4587:Dnah5 UTSW 15 28,304,745 (GRCm39) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,420,140 (GRCm39) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,402,099 (GRCm39) missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28,295,406 (GRCm39) missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28,372,521 (GRCm39) missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28,421,101 (GRCm39) splice site probably null
R4767:Dnah5 UTSW 15 28,270,620 (GRCm39) missense probably benign 0.02
R4857:Dnah5 UTSW 15 28,345,953 (GRCm39) missense probably benign 0.00
R4883:Dnah5 UTSW 15 28,343,784 (GRCm39) missense probably benign 0.00
R4889:Dnah5 UTSW 15 28,235,938 (GRCm39) missense probably benign 0.01
R4946:Dnah5 UTSW 15 28,388,050 (GRCm39) missense probably damaging 1.00
R4946:Dnah5 UTSW 15 28,326,703 (GRCm39) missense probably damaging 0.96
R4947:Dnah5 UTSW 15 28,272,518 (GRCm39) missense probably benign
R5033:Dnah5 UTSW 15 28,421,824 (GRCm39) missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28,408,438 (GRCm39) missense probably benign 0.00
R5175:Dnah5 UTSW 15 28,448,550 (GRCm39) missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28,311,424 (GRCm39) missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28,272,318 (GRCm39) missense probably benign 0.41
R5272:Dnah5 UTSW 15 28,350,811 (GRCm39) missense probably benign
R5308:Dnah5 UTSW 15 28,229,797 (GRCm39) missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28,311,474 (GRCm39) missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28,384,390 (GRCm39) missense probably benign 0.41
R5398:Dnah5 UTSW 15 28,293,872 (GRCm39) missense probably benign
R5596:Dnah5 UTSW 15 28,343,754 (GRCm39) missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28,420,078 (GRCm39) missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28,302,581 (GRCm39) missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28,421,210 (GRCm39) missense probably benign 0.03
R5741:Dnah5 UTSW 15 28,246,513 (GRCm39) missense probably benign 0.11
R5754:Dnah5 UTSW 15 28,402,014 (GRCm39) missense probably benign 0.01
R5763:Dnah5 UTSW 15 28,311,298 (GRCm39) missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28,313,967 (GRCm39) missense probably benign 0.00
R5836:Dnah5 UTSW 15 28,383,738 (GRCm39) missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28,290,341 (GRCm39) missense probably benign 0.00
R5864:Dnah5 UTSW 15 28,297,159 (GRCm39) missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28,234,599 (GRCm39) splice site probably null
R5896:Dnah5 UTSW 15 28,272,206 (GRCm39) missense probably benign
R5899:Dnah5 UTSW 15 28,448,513 (GRCm39) missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28,387,979 (GRCm39) missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28,307,473 (GRCm39) missense probably benign 0.41
R5927:Dnah5 UTSW 15 28,335,864 (GRCm39) missense probably benign 0.00
R5929:Dnah5 UTSW 15 28,311,354 (GRCm39) missense probably damaging 1.00
R5929:Dnah5 UTSW 15 28,311,353 (GRCm39) missense probably benign 0.01
R5931:Dnah5 UTSW 15 28,453,425 (GRCm39) missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28,458,730 (GRCm39) missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28,234,428 (GRCm39) missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28,299,372 (GRCm39) missense probably benign 0.09
R6016:Dnah5 UTSW 15 28,328,030 (GRCm39) missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28,387,979 (GRCm39) missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28,230,614 (GRCm39) missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28,270,566 (GRCm39) missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28,233,377 (GRCm39) missense probably benign 0.05
R6146:Dnah5 UTSW 15 28,459,331 (GRCm39) missense probably benign
R6154:Dnah5 UTSW 15 28,204,177 (GRCm39) missense probably benign 0.15
R6164:Dnah5 UTSW 15 28,378,489 (GRCm39) missense probably benign 0.08
R6266:Dnah5 UTSW 15 28,335,773 (GRCm39) missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28,372,557 (GRCm39) missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28,238,657 (GRCm39) missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28,349,970 (GRCm39) missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28,438,329 (GRCm39) missense probably benign 0.10
R6564:Dnah5 UTSW 15 28,367,891 (GRCm39) missense probably benign
R6607:Dnah5 UTSW 15 28,445,346 (GRCm39) missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28,409,266 (GRCm39) missense probably benign 0.03
R6633:Dnah5 UTSW 15 28,293,933 (GRCm39) missense probably benign 0.27
R6647:Dnah5 UTSW 15 28,403,633 (GRCm39) missense probably benign 0.02
R6782:Dnah5 UTSW 15 28,449,302 (GRCm39) missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28,233,384 (GRCm39) nonsense probably null
R6797:Dnah5 UTSW 15 28,451,609 (GRCm39) missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28,411,661 (GRCm39) missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28,278,770 (GRCm39) missense probably benign 0.14
R6871:Dnah5 UTSW 15 28,229,786 (GRCm39) missense probably benign 0.32
R6936:Dnah5 UTSW 15 28,409,414 (GRCm39) missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28,235,866 (GRCm39) missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28,333,208 (GRCm39) missense probably benign 0.00
R7030:Dnah5 UTSW 15 28,238,738 (GRCm39) missense probably benign
R7032:Dnah5 UTSW 15 28,326,796 (GRCm39) missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28,233,394 (GRCm39) missense probably benign 0.00
R7094:Dnah5 UTSW 15 28,453,482 (GRCm39) missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28,453,410 (GRCm39) missense probably benign 0.00
R7126:Dnah5 UTSW 15 28,349,983 (GRCm39) missense probably benign 0.03
R7153:Dnah5 UTSW 15 28,365,668 (GRCm39) splice site probably null
R7209:Dnah5 UTSW 15 28,459,371 (GRCm39) missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28,367,984 (GRCm39) missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28,270,616 (GRCm39) missense probably null 0.33
R7350:Dnah5 UTSW 15 28,235,965 (GRCm39) critical splice donor site probably null
R7380:Dnah5 UTSW 15 28,370,524 (GRCm39) missense probably damaging 1.00
R7438:Dnah5 UTSW 15 28,347,098 (GRCm39) missense probably damaging 0.99
R7499:Dnah5 UTSW 15 28,302,596 (GRCm39) missense probably damaging 1.00
R7513:Dnah5 UTSW 15 28,370,561 (GRCm39) missense probably benign
R7519:Dnah5 UTSW 15 28,390,629 (GRCm39) missense probably damaging 0.98
R7524:Dnah5 UTSW 15 28,297,212 (GRCm39) missense possibly damaging 0.50
R7556:Dnah5 UTSW 15 28,290,389 (GRCm39) missense probably null 0.43
R7570:Dnah5 UTSW 15 28,347,098 (GRCm39) missense probably damaging 1.00
R7585:Dnah5 UTSW 15 28,402,014 (GRCm39) missense probably benign 0.09
R7642:Dnah5 UTSW 15 28,248,125 (GRCm39) critical splice donor site probably null
R7670:Dnah5 UTSW 15 28,246,378 (GRCm39) splice site probably null
R7763:Dnah5 UTSW 15 28,314,001 (GRCm39) missense probably damaging 1.00
R7821:Dnah5 UTSW 15 28,411,678 (GRCm39) missense possibly damaging 0.89
R7826:Dnah5 UTSW 15 28,367,958 (GRCm39) missense probably damaging 1.00
R7872:Dnah5 UTSW 15 28,245,830 (GRCm39) missense probably damaging 0.99
R7889:Dnah5 UTSW 15 28,448,560 (GRCm39) nonsense probably null
R7919:Dnah5 UTSW 15 28,350,742 (GRCm39) missense probably damaging 1.00
R7920:Dnah5 UTSW 15 28,453,368 (GRCm39) missense probably benign 0.00
R7936:Dnah5 UTSW 15 28,345,983 (GRCm39) missense possibly damaging 0.64
R7996:Dnah5 UTSW 15 28,409,323 (GRCm39) missense probably damaging 0.98
R8063:Dnah5 UTSW 15 28,230,729 (GRCm39) missense probably benign
R8084:Dnah5 UTSW 15 28,388,099 (GRCm39) missense probably damaging 1.00
R8105:Dnah5 UTSW 15 28,372,548 (GRCm39) missense probably benign
R8114:Dnah5 UTSW 15 28,240,122 (GRCm39) missense probably benign 0.01
R8142:Dnah5 UTSW 15 28,384,519 (GRCm39) missense probably benign 0.36
R8153:Dnah5 UTSW 15 28,384,576 (GRCm39) missense probably damaging 1.00
R8161:Dnah5 UTSW 15 28,350,850 (GRCm39) missense possibly damaging 0.79
R8174:Dnah5 UTSW 15 28,311,279 (GRCm39) splice site probably null
R8187:Dnah5 UTSW 15 28,384,355 (GRCm39) missense probably damaging 1.00
R8194:Dnah5 UTSW 15 28,453,414 (GRCm39) missense probably damaging 0.99
R8280:Dnah5 UTSW 15 28,408,538 (GRCm39) missense probably benign 0.01
R8291:Dnah5 UTSW 15 28,263,743 (GRCm39) missense probably benign 0.03
R8324:Dnah5 UTSW 15 28,347,011 (GRCm39) missense probably damaging 1.00
R8347:Dnah5 UTSW 15 28,236,812 (GRCm39) missense possibly damaging 0.90
R8356:Dnah5 UTSW 15 28,444,313 (GRCm39) missense probably benign 0.03
R8356:Dnah5 UTSW 15 28,444,469 (GRCm39) missense probably null 0.02
R8361:Dnah5 UTSW 15 28,331,956 (GRCm39) missense probably damaging 0.98
R8375:Dnah5 UTSW 15 28,327,489 (GRCm39) missense probably benign 0.00
R8474:Dnah5 UTSW 15 28,247,978 (GRCm39) missense probably benign 0.00
R8481:Dnah5 UTSW 15 28,419,941 (GRCm39) missense probably benign 0.00
R8494:Dnah5 UTSW 15 28,345,977 (GRCm39) missense probably benign 0.32
R8495:Dnah5 UTSW 15 28,409,414 (GRCm39) missense probably damaging 0.97
R8519:Dnah5 UTSW 15 28,299,245 (GRCm39) missense probably benign 0.07
R8683:Dnah5 UTSW 15 28,289,367 (GRCm39) missense probably benign 0.00
R8739:Dnah5 UTSW 15 28,346,006 (GRCm39) missense probably benign 0.01
R8752:Dnah5 UTSW 15 28,290,365 (GRCm39) missense probably benign 0.00
R8784:Dnah5 UTSW 15 28,388,097 (GRCm39) missense probably benign 0.16
R8813:Dnah5 UTSW 15 28,229,719 (GRCm39) missense probably damaging 1.00
R8862:Dnah5 UTSW 15 28,459,502 (GRCm39) splice site probably benign
R8873:Dnah5 UTSW 15 28,219,334 (GRCm39) missense probably benign
R8885:Dnah5 UTSW 15 28,327,886 (GRCm39) missense probably damaging 1.00
R8901:Dnah5 UTSW 15 28,365,715 (GRCm39) missense possibly damaging 0.76
R9025:Dnah5 UTSW 15 28,409,412 (GRCm39) missense probably damaging 1.00
R9037:Dnah5 UTSW 15 28,248,104 (GRCm39) missense probably benign 0.05
R9057:Dnah5 UTSW 15 28,391,014 (GRCm39) missense probably damaging 1.00
R9059:Dnah5 UTSW 15 28,245,812 (GRCm39) missense probably benign
R9065:Dnah5 UTSW 15 28,293,936 (GRCm39) missense probably benign 0.09
R9098:Dnah5 UTSW 15 28,420,107 (GRCm39) missense
R9118:Dnah5 UTSW 15 28,401,994 (GRCm39) frame shift probably null
R9149:Dnah5 UTSW 15 28,387,914 (GRCm39) missense probably benign 0.00
R9184:Dnah5 UTSW 15 28,340,552 (GRCm39) missense probably benign 0.13
R9205:Dnah5 UTSW 15 28,448,480 (GRCm39) missense possibly damaging 0.88
R9297:Dnah5 UTSW 15 28,204,054 (GRCm39) start gained probably benign
R9302:Dnah5 UTSW 15 28,240,032 (GRCm39) missense probably benign 0.03
R9310:Dnah5 UTSW 15 28,448,579 (GRCm39) missense probably damaging 1.00
R9318:Dnah5 UTSW 15 28,204,054 (GRCm39) start gained probably benign
R9405:Dnah5 UTSW 15 28,272,306 (GRCm39) missense probably benign
R9424:Dnah5 UTSW 15 28,272,286 (GRCm39) missense probably benign 0.01
R9467:Dnah5 UTSW 15 28,366,293 (GRCm39) missense possibly damaging 0.94
R9469:Dnah5 UTSW 15 28,421,146 (GRCm39) missense probably benign 0.06
R9548:Dnah5 UTSW 15 28,328,025 (GRCm39) missense possibly damaging 0.79
R9564:Dnah5 UTSW 15 28,290,422 (GRCm39) missense probably benign 0.04
R9576:Dnah5 UTSW 15 28,272,286 (GRCm39) missense probably benign 0.01
R9593:Dnah5 UTSW 15 28,236,774 (GRCm39) missense probably benign
R9644:Dnah5 UTSW 15 28,230,650 (GRCm39) missense probably damaging 0.98
R9655:Dnah5 UTSW 15 28,242,900 (GRCm39) missense probably benign
R9657:Dnah5 UTSW 15 28,410,089 (GRCm39) missense probably damaging 1.00
R9704:Dnah5 UTSW 15 28,247,965 (GRCm39) missense probably benign 0.00
R9797:Dnah5 UTSW 15 28,233,316 (GRCm39) missense probably benign 0.34
RF009:Dnah5 UTSW 15 28,204,165 (GRCm39) missense probably benign 0.00
X0011:Dnah5 UTSW 15 28,408,527 (GRCm39) missense probably benign 0.16
X0018:Dnah5 UTSW 15 28,269,500 (GRCm39) missense probably benign 0.00
X0022:Dnah5 UTSW 15 28,270,557 (GRCm39) missense probably benign 0.01
X0023:Dnah5 UTSW 15 28,384,454 (GRCm39) missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28,470,623 (GRCm39) missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28,366,503 (GRCm39) missense probably null 0.10
Z1088:Dnah5 UTSW 15 28,384,376 (GRCm39) missense probably damaging 1.00
Z1177:Dnah5 UTSW 15 28,295,457 (GRCm39) missense probably damaging 0.98
Z1177:Dnah5 UTSW 15 28,270,549 (GRCm39) missense probably benign 0.00
Z1177:Dnah5 UTSW 15 28,270,500 (GRCm39) missense probably benign 0.32
Z1177:Dnah5 UTSW 15 28,387,909 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGAAGCATTTGGAATGTAGGCAGGATT -3'
(R):5'- ACAGTGGCCTCTCCTTTAGAAAGGAT -3'

Sequencing Primer
(F):5'- GGAATGTAGGCAGGATTTTCTTTTC -3'
(R):5'- CCTTTAGAAAGGATGCAGCCTTG -3'
Posted On 2013-07-11