Incidental Mutation 'R7623:Abcc5'
ID589286
Institutional Source Beutler Lab
Gene Symbol Abcc5
Ensembl Gene ENSMUSG00000022822
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 5
Synonyms2900011L11Rik, Abcc5a, Mrp5, Abcc5b
Accession Numbers

Ncbi RefSeq: NM_013790.2, NM_176839.1; MGI:1351644

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7623 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20331303-20426394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20344696 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1264 (D1264N)
Ref Sequence ENSEMBL: ENSMUSP00000078158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079158] [ENSMUST00000115547]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079158
AA Change: D1264N

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078158
Gene: ENSMUSG00000022822
AA Change: D1264N

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 1.6e-18 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1142 9.3e-36 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115547
AA Change: D1264N

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111209
Gene: ENSMUSG00000022822
AA Change: D1264N

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 2e-17 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1146 6.5e-30 PFAM
AAA 1218 1403 1.26e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype Strain: 3794119
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal cGMP transport into erythrocyte membrane vesicles. [provided by MGI curators]
Allele List at MGI

All alleles(81) : Targeted(4) Gene trapped(77)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik G T 16: 21,694,342 L22M probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5430419D17Rik T A 7: 131,277,566 probably null Het
Abca9 T C 11: 110,107,558 N1468S probably benign Het
Abhd10 A G 16: 45,732,736 probably benign Het
Acadvl G T 11: 70,010,743 A570E probably damaging Het
Adgrb3 T A 1: 25,547,548 S355C probably damaging Het
Adgrv1 A G 13: 81,422,225 V4953A possibly damaging Het
Ano2 T A 6: 126,015,573 Y836* probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc8 T A 7: 16,996,612 D675E possibly damaging Het
Ccnb2 A G 9: 70,418,888 V58A probably benign Het
Cdh24 A T 14: 54,638,090 Y296N probably damaging Het
Cfap46 T C 7: 139,618,350 E2054G unknown Het
Cnot1 A T 8: 95,727,648 F2067I probably damaging Het
Csmd3 A G 15: 47,949,938 F329S Het
Dact3 C A 7: 16,885,915 T445K unknown Het
Dph6 C A 2: 114,654,898 probably benign Het
Dst T A 1: 34,170,436 C1195S probably damaging Het
Fam102a A G 2: 32,566,334 D336G possibly damaging Het
Fat3 T A 9: 15,988,324 N3138Y probably damaging Het
Fbxw25 T C 9: 109,654,583 N187S Het
Fuca1 A G 4: 135,933,094 I308V probably benign Het
Galnt5 A G 2: 58,017,210 R562G probably damaging Het
Gas8 G T 8: 123,522,979 R44S probably damaging Het
Gja5 T C 3: 97,050,755 S43P possibly damaging Het
Gm14403 A G 2: 177,508,612 D117G probably benign Het
Gmpr2 G A 14: 55,673,034 V58M probably damaging Het
Gtpbp6 T A 5: 110,105,084 I301F probably damaging Het
Hdhd5 T C 6: 120,521,251 Y129C probably damaging Het
Hemgn A G 4: 46,396,504 M244T probably benign Het
Hist1h2bp T A 13: 21,787,592 D26E probably benign Het
Hoxa1 T G 6: 52,158,258 probably null Het
Iglc1 T A 16: 19,061,801 H90L Het
Lamb2 C T 9: 108,489,224 S1545F possibly damaging Het
Mc4r T C 18: 66,859,509 T178A probably benign Het
Mcam T A 9: 44,139,658 S346T probably benign Het
Mis18bp1 A G 12: 65,148,852 S713P probably benign Het
Mybl2 A G 2: 163,072,832 Y290C probably damaging Het
Olfr1294 T C 2: 111,537,936 M118V probably damaging Het
Olfr859 A T 9: 19,808,929 I204F possibly damaging Het
Pak6 A G 2: 118,694,587 T565A probably damaging Het
Pde5a A G 3: 122,774,601 T284A probably benign Het
Pkd1l2 A T 8: 117,029,645 F1616Y probably damaging Het
Pp2d1 T C 17: 53,515,879 E53G probably benign Het
Ppp3cc A C 14: 70,240,945 S269R probably benign Het
Ptprb A C 10: 116,369,309 D1856A possibly damaging Het
Rgs22 A T 15: 36,040,710 V1001E probably benign Het
Rnf8 T A 17: 29,629,006 V344E probably benign Het
Rpn1 T C 6: 88,084,568 L13P possibly damaging Het
Rsbn1 A T 3: 103,915,010 H187L probably benign Het
Sdr16c6 T A 4: 4,058,801 I262F not run Het
Sec22a A G 16: 35,329,524 F211L probably benign Het
Slc16a4 G A 3: 107,297,981 A42T possibly damaging Het
Smap1 T A 1: 23,848,295 Q386L probably benign Het
Sos1 A T 17: 80,479,894 F10L probably benign Het
Sptbn2 A G 19: 4,726,168 T202A probably damaging Het
Stab1 C A 14: 31,140,621 V2282L probably benign Het
Tmprss11f C T 5: 86,524,160 G391D probably damaging Het
Tnfaip2 A G 12: 111,445,638 S158G probably damaging Het
Trav6d-5 A G 14: 52,795,386 T31A probably benign Het
Tst G A 15: 78,405,703 A44V probably damaging Het
Vmn1r210 A T 13: 22,827,235 F294I probably benign Het
Vwc2 T C 11: 11,116,415 F168L probably damaging Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfp605 A G 5: 110,127,520 Y168C probably benign Het
Zfp790 T A 7: 29,825,705 Y49* probably null Het
Zfp93 T C 7: 24,276,369 F593S probably damaging Het
Zfr C T 15: 12,160,528 T729I possibly damaging Het
Other mutations in Abcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Abcc5 APN 16 20422357 missense probably benign 0.01
IGL00928:Abcc5 APN 16 20398970 unclassified probably benign
IGL01350:Abcc5 APN 16 20368458 missense probably benign 0.00
IGL01774:Abcc5 APN 16 20378457 missense probably damaging 1.00
IGL01934:Abcc5 APN 16 20422441 utr 5 prime probably benign
IGL02413:Abcc5 APN 16 20422437 utr 5 prime probably benign
IGL02426:Abcc5 APN 16 20338925 missense probably damaging 0.98
IGL02797:Abcc5 APN 16 20368464 missense probably benign 0.06
IGL02938:Abcc5 APN 16 20362229 missense possibly damaging 0.64
IGL03367:Abcc5 APN 16 20392811 utr 3 prime probably benign
IGL03411:Abcc5 APN 16 20399560 missense probably damaging 0.97
PIT4508001:Abcc5 UTSW 16 20357378 missense probably damaging 0.97
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0220:Abcc5 UTSW 16 20369102 missense probably benign
R0281:Abcc5 UTSW 16 20422400 missense probably damaging 1.00
R0401:Abcc5 UTSW 16 20376558 missense probably benign 0.09
R0448:Abcc5 UTSW 16 20399937 missense probably damaging 1.00
R0477:Abcc5 UTSW 16 20368569 missense possibly damaging 0.51
R0477:Abcc5 UTSW 16 20398885 missense probably damaging 0.96
R0601:Abcc5 UTSW 16 20404559 splice site probably benign
R0648:Abcc5 UTSW 16 20365882 missense possibly damaging 0.90
R0709:Abcc5 UTSW 16 20376592 missense possibly damaging 0.91
R1144:Abcc5 UTSW 16 20422438 utr 5 prime probably benign
R1552:Abcc5 UTSW 16 20398867 missense probably damaging 0.99
R1625:Abcc5 UTSW 16 20365817 missense probably damaging 0.99
R1748:Abcc5 UTSW 16 20333588 missense probably benign 0.01
R1789:Abcc5 UTSW 16 20365951 missense probably damaging 1.00
R1801:Abcc5 UTSW 16 20338887 missense probably benign 0.43
R1909:Abcc5 UTSW 16 20376509 critical splice donor site probably null
R2046:Abcc5 UTSW 16 20399817 missense possibly damaging 0.90
R2203:Abcc5 UTSW 16 20405882 missense possibly damaging 0.91
R3031:Abcc5 UTSW 16 20375113 missense probably damaging 0.99
R3417:Abcc5 UTSW 16 20405552 splice site probably benign
R3708:Abcc5 UTSW 16 20372180 missense probably benign 0.30
R3731:Abcc5 UTSW 16 20398934 nonsense probably null
R3829:Abcc5 UTSW 16 20365865 missense probably benign 0.00
R3847:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3850:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3955:Abcc5 UTSW 16 20405543 missense probably damaging 0.97
R4072:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4432:Abcc5 UTSW 16 20368187 intron probably null
R4433:Abcc5 UTSW 16 20368187 intron probably null
R4505:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4506:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4715:Abcc5 UTSW 16 20398876 missense probably damaging 1.00
R4739:Abcc5 UTSW 16 20399626 missense probably damaging 1.00
R4866:Abcc5 UTSW 16 20422432 start codon destroyed probably null 1.00
R4905:Abcc5 UTSW 16 20399928 missense probably damaging 1.00
R4907:Abcc5 UTSW 16 20376546 missense possibly damaging 0.86
R5088:Abcc5 UTSW 16 20376662 missense probably damaging 1.00
R5232:Abcc5 UTSW 16 20338922 missense probably damaging 0.96
R5559:Abcc5 UTSW 16 20338886 missense probably damaging 1.00
R5647:Abcc5 UTSW 16 20399847 missense probably damaging 1.00
R5861:Abcc5 UTSW 16 20399894 missense probably damaging 1.00
R6190:Abcc5 UTSW 16 20392779 missense probably benign 0.02
R6213:Abcc5 UTSW 16 20400012 missense probably damaging 1.00
R6511:Abcc5 UTSW 16 20376594 missense probably damaging 0.99
R6732:Abcc5 UTSW 16 20404684 missense probably benign 0.01
R6815:Abcc5 UTSW 16 20333630 missense probably damaging 1.00
R6913:Abcc5 UTSW 16 20378744 missense possibly damaging 0.73
R6945:Abcc5 UTSW 16 20400009 missense probably benign
R7167:Abcc5 UTSW 16 20405501 missense possibly damaging 0.70
R7276:Abcc5 UTSW 16 20376508 splice site probably null
R7318:Abcc5 UTSW 16 20392543 missense probably benign 0.01
R7380:Abcc5 UTSW 16 20397034 missense possibly damaging 0.84
R7419:Abcc5 UTSW 16 20422423 missense possibly damaging 0.57
R7451:Abcc5 UTSW 16 20375070 missense probably damaging 1.00
R7475:Abcc5 UTSW 16 20399989 missense probably benign 0.04
R7567:Abcc5 UTSW 16 20405510 missense probably damaging 1.00
R7601:Abcc5 UTSW 16 20375132 nonsense probably null
R7682:Abcc5 UTSW 16 20368053 missense probably damaging 1.00
R8128:Abcc5 UTSW 16 20365723 missense probably damaging 0.98
X0022:Abcc5 UTSW 16 20392587 missense probably damaging 1.00
X0053:Abcc5 UTSW 16 20364042 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTCGTCACTGCGATAGGAAT -3'
(R):5'- CATGCTTCTACGAGAGCCG -3'

Sequencing Primer
(F):5'- TCGTCACTGCGATAGGAATCACAG -3'
(R):5'- ATGTCTCAAATGGCCGTCAG -3'
Posted On2019-10-24