Incidental Mutation 'R7623:Sos1'
ID589293
Institutional Source Beutler Lab
Gene Symbol Sos1
Ensembl Gene ENSMUSG00000024241
Gene NameSOS Ras/Rac guanine nucleotide exchange factor 1
Synonyms4430401P03Rik
Accession Numbers

Genbank: NM_009231.2; Ensembl: ENSMUST00000068714

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7623 (G1)
Quality Score92.0077
Status Not validated
Chromosome17
Chromosomal Location80393752-80480453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80479894 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 10 (F10L)
Ref Sequence ENSEMBL: ENSMUSP00000067786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068714]
PDB Structure
CRK SH3 DOMAIN COMPLEXED WITH PEPTOID INHIBITOR [X-RAY DIFFRACTION]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
PLECKSTRIN HOMOLOGY DOMAIN OF SON OF SEVENLESS 1 (SOS1) WITH GLYCINE-SERINE ADDED TO THE N-TERMINUS, NMR, 20 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000068714
AA Change: F10L

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000067786
Gene: ENSMUSG00000024241
AA Change: F10L

DomainStartEndE-ValueType
Pfam:Histone 40 169 6.8e-16 PFAM
RhoGEF 204 389 8.5e-35 SMART
PH 444 548 2.44e-17 SMART
RasGEFN 596 741 2.18e-56 SMART
RasGEF 776 1020 4.44e-102 SMART
low complexity region 1079 1093 N/A INTRINSIC
low complexity region 1116 1127 N/A INTRINSIC
low complexity region 1132 1154 N/A INTRINSIC
Blast:RasGEF 1155 1306 1e-51 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins. The product of this gene may regulate RAS proteins by facilitating the exchange of GTP for GDP. Mutations in this gene are associated with gingival fibromatosis 1 and Noonan syndrome type 4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutant embryos exhibit placental and cardiovascular defects resulting in death around mid-gestation. When heterozygous, these mutations enhance the eye defects of homozygous mutants of the epidermal growth factor receptor gene. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(21)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik G T 16: 21,694,342 L22M probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
Abca9 T C 11: 110,107,558 N1468S probably benign Het
Abcc5 C T 16: 20,344,696 D1264N possibly damaging Het
Acadvl G T 11: 70,010,743 A570E probably damaging Het
Adgrb3 T A 1: 25,547,548 S355C probably damaging Het
Adgrv1 A G 13: 81,422,225 V4953A possibly damaging Het
Ano2 T A 6: 126,015,573 Y836* probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc8 T A 7: 16,996,612 D675E possibly damaging Het
Ccnb2 A G 9: 70,418,888 V58A probably benign Het
Cdh24 A T 14: 54,638,090 Y296N probably damaging Het
Cfap46 T C 7: 139,618,350 E2054G unknown Het
Cnot1 A T 8: 95,727,648 F2067I probably damaging Het
Csmd3 A G 15: 47,949,938 F329S Het
Dact3 C A 7: 16,885,915 T445K unknown Het
Dph6 C A 2: 114,654,898 probably benign Het
Dst T A 1: 34,170,436 C1195S probably damaging Het
Fam102a A G 2: 32,566,334 D336G possibly damaging Het
Fat3 T A 9: 15,988,324 N3138Y probably damaging Het
Fbxw25 T C 9: 109,654,583 N187S Het
Fuca1 A G 4: 135,933,094 I308V probably benign Het
Galnt5 A G 2: 58,017,210 R562G probably damaging Het
Gas8 G T 8: 123,522,979 R44S probably damaging Het
Gja5 T C 3: 97,050,755 S43P possibly damaging Het
Gm14403 A G 2: 177,508,612 D117G probably benign Het
Gmpr2 G A 14: 55,673,034 V58M probably damaging Het
Gtpbp6 T A 5: 110,105,084 I301F probably damaging Het
Hdhd5 T C 6: 120,521,251 Y129C probably damaging Het
Hemgn A G 4: 46,396,504 M244T probably benign Het
Hist1h2bp T A 13: 21,787,592 D26E probably benign Het
Iglc1 T A 16: 19,061,801 H90L Het
Lamb2 C T 9: 108,489,224 S1545F possibly damaging Het
Mc4r T C 18: 66,859,509 T178A probably benign Het
Mcam T A 9: 44,139,658 S346T probably benign Het
Mis18bp1 A G 12: 65,148,852 S713P probably benign Het
Mybl2 A G 2: 163,072,832 Y290C probably damaging Het
Olfr1294 T C 2: 111,537,936 M118V probably damaging Het
Olfr859 A T 9: 19,808,929 I204F possibly damaging Het
Pak6 A G 2: 118,694,587 T565A probably damaging Het
Pde5a A G 3: 122,774,601 T284A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pkd1l2 A T 8: 117,029,645 F1616Y probably damaging Het
Pp2d1 T C 17: 53,515,879 E53G probably benign Het
Ppp3cc A C 14: 70,240,945 S269R probably benign Het
Ptprb A C 10: 116,369,309 D1856A possibly damaging Het
Rgs22 A T 15: 36,040,710 V1001E probably benign Het
Rnf8 T A 17: 29,629,006 V344E probably benign Het
Rpn1 T C 6: 88,084,568 L13P possibly damaging Het
Rsbn1 A T 3: 103,915,010 H187L probably benign Het
Sdr16c6 T A 4: 4,058,801 I262F not run Het
Sec22a A G 16: 35,329,524 F211L probably benign Het
Slc16a4 G A 3: 107,297,981 A42T possibly damaging Het
Smap1 T A 1: 23,848,295 Q386L probably benign Het
Sptbn2 A G 19: 4,726,168 T202A probably damaging Het
Stab1 C A 14: 31,140,621 V2282L probably benign Het
Tmprss11f C T 5: 86,524,160 G391D probably damaging Het
Tnfaip2 A G 12: 111,445,638 S158G probably damaging Het
Trav6d-5 A G 14: 52,795,386 T31A probably benign Het
Tst G A 15: 78,405,703 A44V probably damaging Het
Vmn1r210 A T 13: 22,827,235 F294I probably benign Het
Vwc2 T C 11: 11,116,415 F168L probably damaging Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfp605 A G 5: 110,127,520 Y168C probably benign Het
Zfp790 T A 7: 29,825,705 Y49* probably null Het
Zfp93 T C 7: 24,276,369 F593S probably damaging Het
Zfr C T 15: 12,160,528 T729I possibly damaging Het
Other mutations in Sos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Sos1 APN 17 80398524 missense possibly damaging 0.94
IGL00915:Sos1 APN 17 80433938 missense probably benign 0.00
IGL00929:Sos1 APN 17 80408596 missense probably damaging 1.00
IGL01073:Sos1 APN 17 80422747 missense probably damaging 1.00
IGL01116:Sos1 APN 17 80445500 missense probably damaging 1.00
IGL01533:Sos1 APN 17 80415082 missense probably damaging 0.97
IGL01546:Sos1 APN 17 80408611 missense probably damaging 1.00
IGL01583:Sos1 APN 17 80433900 missense probably benign 0.11
IGL01628:Sos1 APN 17 80422677 splice site probably benign
IGL01837:Sos1 APN 17 80422728 missense probably damaging 1.00
IGL02170:Sos1 APN 17 80398290 missense probably damaging 0.99
IGL02426:Sos1 APN 17 80434943 missense possibly damaging 0.82
IGL02992:Sos1 APN 17 80419016 missense probably benign 0.01
IGL03037:Sos1 APN 17 80420329 missense probably damaging 0.98
1mM(1):Sos1 UTSW 17 80455057 missense possibly damaging 0.46
PIT4354001:Sos1 UTSW 17 80449356 missense possibly damaging 0.52
R0056:Sos1 UTSW 17 80413621 missense probably damaging 1.00
R0348:Sos1 UTSW 17 80408311 missense probably benign
R0373:Sos1 UTSW 17 80453763 missense probably damaging 1.00
R0477:Sos1 UTSW 17 80434934 missense possibly damaging 0.92
R0621:Sos1 UTSW 17 80451979 critical splice donor site probably null
R0839:Sos1 UTSW 17 80433730 missense probably damaging 1.00
R1174:Sos1 UTSW 17 80445608 nonsense probably null
R1490:Sos1 UTSW 17 80413675 missense probably benign 0.11
R1566:Sos1 UTSW 17 80453916 missense probably damaging 0.99
R1635:Sos1 UTSW 17 80422679 splice site probably null
R3412:Sos1 UTSW 17 80406717 missense probably benign
R3770:Sos1 UTSW 17 80398308 missense probably damaging 0.97
R3951:Sos1 UTSW 17 80424181 missense probably damaging 1.00
R3964:Sos1 UTSW 17 80455179 missense probably damaging 1.00
R3966:Sos1 UTSW 17 80455179 missense probably damaging 1.00
R4086:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4087:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4089:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4194:Sos1 UTSW 17 80398584 missense probably benign 0.02
R4468:Sos1 UTSW 17 80453811 missense probably damaging 1.00
R4469:Sos1 UTSW 17 80453811 missense probably damaging 1.00
R4597:Sos1 UTSW 17 80433826 missense probably benign 0.05
R4773:Sos1 UTSW 17 80398231 missense probably damaging 0.99
R4923:Sos1 UTSW 17 80434952 missense probably benign 0.10
R5120:Sos1 UTSW 17 80408248 missense probably damaging 0.98
R5478:Sos1 UTSW 17 80433847 missense probably damaging 1.00
R5566:Sos1 UTSW 17 80453890 missense possibly damaging 0.91
R5984:Sos1 UTSW 17 80452132 missense possibly damaging 0.68
R6053:Sos1 UTSW 17 80415034 missense possibly damaging 0.94
R6153:Sos1 UTSW 17 80449335 missense probably benign 0.01
R6567:Sos1 UTSW 17 80433503 missense probably damaging 1.00
R7392:Sos1 UTSW 17 80424200 missense probably damaging 1.00
R7763:Sos1 UTSW 17 80413713 missense probably benign
X0020:Sos1 UTSW 17 80449277 missense probably damaging 1.00
Z1177:Sos1 UTSW 17 80453918 missense not run
Predicted Primers PCR Primer
(F):5'- AGTGTCAACAGCTGGAGCAG -3'
(R):5'- GGTTCAGTTTGCTAGTAGGAAGCTC -3'

Sequencing Primer
(F):5'- TCGCAGCCCGAGCAGAC -3'
(R):5'- GGGCCTCTCGCTTGAGTTC -3'
Posted On2019-10-24