Incidental Mutation 'R7624:Or12e10'
ID 589301
Institutional Source Beutler Lab
Gene Symbol Or12e10
Ensembl Gene ENSMUSG00000068814
Gene Name olfactory receptor family 12 subfamily E member 10
Synonyms Olfr1145, GA_x6K02T2Q125-49311440-49312384, MOR264-19
MMRRC Submission 045689-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7624 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 87640166-87641143 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87640683 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 173 (Q173R)
Ref Sequence ENSEMBL: ENSMUSP00000088209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079711] [ENSMUST00000090707]
AlphaFold A2AVC7
Predicted Effect probably damaging
Transcript: ENSMUST00000079711
AA Change: Q162R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078649
Gene: ENSMUSG00000068814
AA Change: Q162R

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.4e-52 PFAM
Pfam:7tm_1 47 296 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090707
AA Change: Q173R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088209
Gene: ENSMUSG00000068814
AA Change: Q173R

DomainStartEndE-ValueType
transmembrane domain 21 38 N/A INTRINSIC
Pfam:7tm_4 48 325 6.2e-58 PFAM
Pfam:7tm_1 58 307 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm C A 9: 53,366,068 (GRCm39) R2533L probably damaging Het
Caprin1 T A 2: 103,603,022 (GRCm39) M514L possibly damaging Het
Ccdc78 A G 17: 26,006,126 (GRCm39) E98G probably damaging Het
Cmya5 A T 13: 93,226,865 (GRCm39) M2741K possibly damaging Het
Cnot1 T G 8: 96,478,447 (GRCm39) R959S probably damaging Het
Col12a1 G T 9: 79,553,076 (GRCm39) probably null Het
Col4a3 A G 1: 82,696,605 (GRCm39) T177A probably benign Het
Cpa3 T C 3: 20,279,307 (GRCm39) N211D possibly damaging Het
Cripto C T 9: 110,775,017 (GRCm39) probably benign Het
Cryba1 T C 11: 77,613,543 (GRCm39) Y36C probably damaging Het
Ctnna1 T A 18: 35,377,897 (GRCm39) I632N probably benign Het
D630045J12Rik T C 6: 38,126,498 (GRCm39) N1504S probably damaging Het
Dgkz C A 2: 91,773,019 (GRCm39) R346L probably damaging Het
Dnajc21 G A 15: 10,461,318 (GRCm39) R211C probably benign Het
Dnajc21 A T 15: 10,461,320 (GRCm39) I210N probably damaging Het
Dscam T C 16: 96,411,524 (GRCm39) D1784G probably damaging Het
Eya3 A G 4: 132,400,262 (GRCm39) T94A probably benign Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fat3 T C 9: 15,871,165 (GRCm39) D3742G possibly damaging Het
Ficd T C 5: 113,876,751 (GRCm39) F309L probably benign Het
Gfra1 A T 19: 58,226,878 (GRCm39) M451K probably benign Het
Gm43517 T A 12: 49,437,961 (GRCm39) L318Q Het
Gsc A T 12: 104,439,310 (GRCm39) V22E possibly damaging Het
Il4ra T C 7: 125,168,280 (GRCm39) Y100H probably damaging Het
Ilf3 T C 9: 21,309,340 (GRCm39) S486P probably benign Het
Itga10 T A 3: 96,560,269 (GRCm39) H594Q probably benign Het
Kcnf1 T C 12: 17,226,137 (GRCm39) D28G probably benign Het
Kiss1 A G 1: 133,257,160 (GRCm39) K53R possibly damaging Het
Lcn5 A G 2: 25,551,426 (GRCm39) I182V probably benign Het
Lcorl T C 5: 45,859,307 (GRCm39) D269G probably benign Het
Letm2 A T 8: 26,082,553 (GRCm39) C174* probably null Het
Met T G 6: 17,558,834 (GRCm39) V1154G probably damaging Het
Mindy3 A G 2: 12,424,000 (GRCm39) S22P probably benign Het
Mroh2b G A 15: 4,946,613 (GRCm39) R471Q probably damaging Het
Nfe2l3 T C 6: 51,435,252 (GRCm39) L604P probably damaging Het
Or14a256 A G 7: 86,265,769 (GRCm39) F28S possibly damaging Het
Or5h18 T A 16: 58,847,382 (GRCm39) Q296L possibly damaging Het
Or8b3b C T 9: 38,583,919 (GRCm39) V274I probably benign Het
Or8u9 A T 2: 86,001,564 (GRCm39) I199N possibly damaging Het
Or9r7 A C 10: 129,962,455 (GRCm39) I157S probably damaging Het
Pcdha9 T A 18: 37,132,849 (GRCm39) Y639* probably null Het
Pom121l2 A T 13: 22,167,699 (GRCm39) I657L probably damaging Het
Prr14l T A 5: 32,986,967 (GRCm39) T843S possibly damaging Het
Rln1 A T 19: 29,309,499 (GRCm39) N93K probably damaging Het
Rpl3l A T 17: 24,951,401 (GRCm39) M101L probably benign Het
Rtkn A G 6: 83,129,158 (GRCm39) Y551C probably benign Het
Rundc1 G C 11: 101,324,305 (GRCm39) R337P possibly damaging Het
Scarf1 T A 11: 75,405,242 (GRCm39) probably null Het
Serpinb1b T A 13: 33,275,622 (GRCm39) probably null Het
Sgsm1 A T 5: 113,422,201 (GRCm39) C484* probably null Het
Slc22a19 T A 19: 7,650,668 (GRCm39) K547* probably null Het
Slc22a19 T C 19: 7,671,183 (GRCm39) T177A probably benign Het
Slc6a5 A C 7: 49,591,614 (GRCm39) K526N probably benign Het
Sqle G A 15: 59,202,603 (GRCm39) R519Q probably benign Het
Stard9 T C 2: 120,518,627 (GRCm39) I517T probably benign Het
Taf15 A T 11: 83,395,849 (GRCm39) D518V unknown Het
Tenm4 A G 7: 96,545,192 (GRCm39) M2440V possibly damaging Het
Tm6sf1 A G 7: 81,518,458 (GRCm39) M122V possibly damaging Het
Tmprss9 T A 10: 80,728,053 (GRCm39) S548T possibly damaging Het
Trim62 A T 4: 128,777,471 (GRCm39) probably benign Het
Ugt2b34 C T 5: 87,039,141 (GRCm39) V507M possibly damaging Het
Usp16 T A 16: 87,273,693 (GRCm39) M423K probably benign Het
Vmn1r199 T A 13: 22,566,906 (GRCm39) S67T probably benign Het
Vmn1r62 A T 7: 5,678,600 (GRCm39) M94L probably benign Het
Wnk4 G T 11: 101,155,180 (GRCm39) E364* probably null Het
Xpo1 T A 11: 23,232,584 (GRCm39) I368N probably damaging Het
Zfp366 A G 13: 99,382,804 (GRCm39) T656A probably benign Het
Zfp934 T C 13: 62,666,338 (GRCm39) M113V probably benign Het
Zkscan2 A G 7: 123,097,994 (GRCm39) V134A probably damaging Het
Other mutations in Or12e10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Or12e10 APN 2 87,640,992 (GRCm39) missense probably damaging 1.00
IGL01335:Or12e10 APN 2 87,640,790 (GRCm39) missense probably damaging 1.00
PIT4418001:Or12e10 UTSW 2 87,640,938 (GRCm39) missense probably damaging 0.99
R1512:Or12e10 UTSW 2 87,640,988 (GRCm39) missense probably benign 0.23
R1700:Or12e10 UTSW 2 87,641,112 (GRCm39) missense probably benign
R2127:Or12e10 UTSW 2 87,640,685 (GRCm39) missense probably benign 0.09
R2162:Or12e10 UTSW 2 87,640,704 (GRCm39) missense probably damaging 1.00
R3707:Or12e10 UTSW 2 87,640,520 (GRCm39) missense probably damaging 1.00
R4327:Or12e10 UTSW 2 87,640,496 (GRCm39) missense probably benign 0.00
R4422:Or12e10 UTSW 2 87,640,989 (GRCm39) missense probably damaging 0.97
R4854:Or12e10 UTSW 2 87,640,934 (GRCm39) missense probably damaging 1.00
R5234:Or12e10 UTSW 2 87,641,112 (GRCm39) missense probably benign
R5858:Or12e10 UTSW 2 87,640,985 (GRCm39) missense probably benign 0.22
R6229:Or12e10 UTSW 2 87,640,431 (GRCm39) missense probably damaging 1.00
R6991:Or12e10 UTSW 2 87,640,787 (GRCm39) missense possibly damaging 0.76
R7007:Or12e10 UTSW 2 87,640,230 (GRCm39) missense probably damaging 1.00
R7027:Or12e10 UTSW 2 87,641,060 (GRCm39) missense possibly damaging 0.90
R7260:Or12e10 UTSW 2 87,640,731 (GRCm39) missense probably damaging 0.98
R7794:Or12e10 UTSW 2 87,640,818 (GRCm39) missense probably damaging 0.97
R8029:Or12e10 UTSW 2 87,640,376 (GRCm39) missense probably benign 0.00
R8378:Or12e10 UTSW 2 87,640,394 (GRCm39) missense probably damaging 1.00
R8399:Or12e10 UTSW 2 87,640,568 (GRCm39) missense probably damaging 1.00
R8468:Or12e10 UTSW 2 87,641,082 (GRCm39) missense possibly damaging 0.95
R8514:Or12e10 UTSW 2 87,641,054 (GRCm39) missense probably damaging 0.97
R9045:Or12e10 UTSW 2 87,640,416 (GRCm39) missense probably damaging 1.00
R9446:Or12e10 UTSW 2 87,640,199 (GRCm39) missense probably benign 0.26
R9513:Or12e10 UTSW 2 87,640,187 (GRCm39) missense possibly damaging 0.91
R9548:Or12e10 UTSW 2 87,641,097 (GRCm39) missense probably damaging 1.00
R9749:Or12e10 UTSW 2 87,640,202 (GRCm39) missense probably benign 0.05
Z1088:Or12e10 UTSW 2 87,641,090 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACATTTCTGTGCTGGCTTG -3'
(R):5'- ACCTCAAGATGGTGGCAATG -3'

Sequencing Primer
(F):5'- CTGGCTTGTGCTGTGCAGATG -3'
(R):5'- TGCTGTAGGATGTAAGCACC -3'
Posted On 2019-10-24