Incidental Mutation 'R7624:Dgkz'
ID589302
Institutional Source Beutler Lab
Gene Symbol Dgkz
Ensembl Gene ENSMUSG00000040479
Gene Namediacylglycerol kinase zeta
SynonymsE130307B02Rik, mDGK[z]
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7624 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91932824-91975864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 91942674 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 346 (R346L)
Ref Sequence ENSEMBL: ENSMUSP00000106934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028667] [ENSMUST00000099709] [ENSMUST00000111303] [ENSMUST00000128152] [ENSMUST00000142090] [ENSMUST00000142231] [ENSMUST00000178895]
Predicted Effect probably benign
Transcript: ENSMUST00000028667
AA Change: R152L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028667
Gene: ENSMUSG00000040479
AA Change: R152L

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
C1 96 153 2.67e-1 SMART
C1 173 231 8.18e-7 SMART
low complexity region 257 274 N/A INTRINSIC
DAGKc 296 420 4.61e-65 SMART
DAGKa 447 604 2.75e-95 SMART
low complexity region 762 780 N/A INTRINSIC
ANK 823 853 8.52e-4 SMART
ANK 858 887 2.18e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099709
AA Change: R169L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106937
Gene: ENSMUSG00000040479
AA Change: R169L

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
C1 113 170 2.67e-1 SMART
C1 190 248 8.18e-7 SMART
low complexity region 274 291 N/A INTRINSIC
DAGKc 313 437 4.61e-65 SMART
DAGKa 464 621 2.75e-95 SMART
low complexity region 779 797 N/A INTRINSIC
ANK 840 870 8.52e-4 SMART
ANK 875 904 2.18e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111303
AA Change: R346L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106934
Gene: ENSMUSG00000040479
AA Change: R346L

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
low complexity region 118 133 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
C1 290 347 2.67e-1 SMART
C1 367 425 8.18e-7 SMART
low complexity region 451 468 N/A INTRINSIC
DAGKc 490 614 4.61e-65 SMART
DAGKa 641 798 2.75e-95 SMART
low complexity region 956 974 N/A INTRINSIC
ANK 1017 1047 8.52e-4 SMART
ANK 1052 1081 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128152
SMART Domains Protein: ENSMUSP00000118684
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:C1 62 114 9e-33 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142090
Predicted Effect unknown
Transcript: ENSMUST00000142231
AA Change: A63S
SMART Domains Protein: ENSMUSP00000114740
Gene: ENSMUSG00000040479
AA Change: A63S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178895
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It may attenuate protein kinase C activity by regulating diacylglycerol levels in intracellular signaling cascade and signal transduction. Alternative splicing occurs at this locus and multiple transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2010]
PHENOTYPE: The T cell response is enhanced in homozygous mutant mice, which showed a robust response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm C A 9: 53,454,768 R2533L probably damaging Het
Caprin1 T A 2: 103,772,677 M514L possibly damaging Het
Ccdc78 A G 17: 25,787,152 E98G probably damaging Het
Cmya5 A T 13: 93,090,357 M2741K possibly damaging Het
Cnot1 T G 8: 95,751,819 R959S probably damaging Het
Col12a1 G T 9: 79,645,794 probably null Het
Col4a3 A G 1: 82,718,884 T177A probably benign Het
Cpa3 T C 3: 20,225,143 N211D possibly damaging Het
Cryba1 T C 11: 77,722,717 Y36C probably damaging Het
Ctnna1 T A 18: 35,244,844 I632N probably benign Het
D630045J12Rik T C 6: 38,149,563 N1504S probably damaging Het
Dnajc21 G A 15: 10,461,232 R211C probably benign Het
Dnajc21 A T 15: 10,461,234 I210N probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Eya3 A G 4: 132,672,951 T94A probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T C 9: 15,959,869 D3742G possibly damaging Het
Ficd T C 5: 113,738,690 F309L probably benign Het
Gfra1 A T 19: 58,238,446 M451K probably benign Het
Gm43517 T A 12: 49,391,178 L318Q Het
Gsc A T 12: 104,473,051 V22E possibly damaging Het
Il4ra T C 7: 125,569,108 Y100H probably damaging Het
Ilf3 T C 9: 21,398,044 S486P probably benign Het
Itga10 T A 3: 96,652,953 H594Q probably benign Het
Kcnf1 T C 12: 17,176,136 D28G probably benign Het
Kiss1 A G 1: 133,329,422 K53R possibly damaging Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Lcorl T C 5: 45,701,965 D269G probably benign Het
Letm2 A T 8: 25,592,537 C174* probably null Het
Met T G 6: 17,558,835 V1154G probably damaging Het
Mindy3 A G 2: 12,419,189 S22P probably benign Het
Mroh2b G A 15: 4,917,131 R471Q probably damaging Het
Nfe2l3 T C 6: 51,458,272 L604P probably damaging Het
Olfr1044 A T 2: 86,171,220 I199N possibly damaging Het
Olfr1145 A G 2: 87,810,339 Q173R probably damaging Het
Olfr186 T A 16: 59,027,019 Q296L possibly damaging Het
Olfr294 A G 7: 86,616,561 F28S possibly damaging Het
Olfr824 A C 10: 130,126,586 I157S probably damaging Het
Olfr918 C T 9: 38,672,623 V274I probably benign Het
Pcdha9 T A 18: 36,999,796 Y639* probably null Het
Pom121l2 A T 13: 21,983,529 I657L probably damaging Het
Prr14l T A 5: 32,829,623 T843S possibly damaging Het
Rln1 A T 19: 29,332,099 N93K probably damaging Het
Rpl3l A T 17: 24,732,427 M101L probably benign Het
Rtkn A G 6: 83,152,177 Y551C probably benign Het
Rundc1 G C 11: 101,433,479 R337P possibly damaging Het
Scarf1 T A 11: 75,514,416 probably null Het
Serpinb1b T A 13: 33,091,639 probably null Het
Sgsm1 A T 5: 113,274,335 C484* probably null Het
Slc22a19 T A 19: 7,673,303 K547* probably null Het
Slc22a19 T C 19: 7,693,818 T177A probably benign Het
Slc6a5 A C 7: 49,941,866 K526N probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stard9 T C 2: 120,688,146 I517T probably benign Het
Taf15 A T 11: 83,505,023 D518V unknown Het
Tdgf1 C T 9: 110,945,949 probably benign Het
Tenm4 A G 7: 96,895,985 M2440V possibly damaging Het
Tm6sf1 A G 7: 81,868,710 M122V possibly damaging Het
Tmprss9 T A 10: 80,892,219 S548T possibly damaging Het
Trim62 A T 4: 128,883,678 probably benign Het
Ugt2b34 C T 5: 86,891,282 V507M possibly damaging Het
Usp16 T A 16: 87,476,805 M423K probably benign Het
Vmn1r199 T A 13: 22,382,736 S67T probably benign Het
Vmn1r62 A T 7: 5,675,601 M94L probably benign Het
Wnk4 G T 11: 101,264,354 E364* probably null Het
Xpo1 T A 11: 23,282,584 I368N probably damaging Het
Zfp366 A G 13: 99,246,296 T656A probably benign Het
Zfp934 T C 13: 62,518,524 M113V probably benign Het
Zkscan2 A G 7: 123,498,771 V134A probably damaging Het
Other mutations in Dgkz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Dgkz APN 2 91935865 missense probably benign 0.00
IGL01995:Dgkz APN 2 91934050 splice site probably benign
IGL02247:Dgkz APN 2 91937460 missense probably benign 0.00
IGL02573:Dgkz APN 2 91934197 missense probably damaging 0.98
IGL02627:Dgkz APN 2 91938710 splice site probably benign
IGL02903:Dgkz APN 2 91939962 missense possibly damaging 0.45
IGL03106:Dgkz APN 2 91940859 missense probably damaging 0.99
R0103:Dgkz UTSW 2 91934205 missense probably benign
R0312:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R0761:Dgkz UTSW 2 91945351 missense probably benign 0.00
R0839:Dgkz UTSW 2 91935111 missense probably benign 0.00
R1162:Dgkz UTSW 2 91944444 missense probably damaging 1.00
R1223:Dgkz UTSW 2 91939315 splice site probably benign
R1539:Dgkz UTSW 2 91938060 missense probably damaging 1.00
R1934:Dgkz UTSW 2 91937104 missense possibly damaging 0.92
R1936:Dgkz UTSW 2 91937978 missense possibly damaging 0.94
R3438:Dgkz UTSW 2 91934050 splice site probably benign
R3804:Dgkz UTSW 2 91939630 missense probably benign 0.06
R4675:Dgkz UTSW 2 91938346 nonsense probably null
R4731:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4732:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4733:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4901:Dgkz UTSW 2 91936731 missense probably benign
R4972:Dgkz UTSW 2 91945702 missense probably benign 0.00
R5027:Dgkz UTSW 2 91945543 missense probably benign 0.02
R5128:Dgkz UTSW 2 91942683 missense probably damaging 1.00
R5408:Dgkz UTSW 2 91935823 missense possibly damaging 0.91
R5494:Dgkz UTSW 2 91941049 splice site probably null
R5728:Dgkz UTSW 2 91945787 missense possibly damaging 0.93
R5813:Dgkz UTSW 2 91939388 missense possibly damaging 0.50
R6025:Dgkz UTSW 2 91945910 missense possibly damaging 0.75
R6043:Dgkz UTSW 2 91935889 missense probably benign 0.03
R6328:Dgkz UTSW 2 91942635 missense probably benign 0.04
R6335:Dgkz UTSW 2 91944379 missense probably benign 0.16
R7381:Dgkz UTSW 2 91944835 missense probably benign 0.02
R7541:Dgkz UTSW 2 91942675 missense probably damaging 1.00
R7560:Dgkz UTSW 2 91942815 unclassified probably benign
R7608:Dgkz UTSW 2 91934054 critical splice donor site probably null
R7709:Dgkz UTSW 2 91937059 missense probably benign 0.02
R7938:Dgkz UTSW 2 91965472 missense probably damaging 0.96
R8183:Dgkz UTSW 2 91939592 missense probably damaging 1.00
R8233:Dgkz UTSW 2 91939649 missense probably damaging 1.00
R8415:Dgkz UTSW 2 91940304 missense possibly damaging 0.80
R8416:Dgkz UTSW 2 91940304 missense possibly damaging 0.80
R8757:Dgkz UTSW 2 91945577 missense probably benign
R8759:Dgkz UTSW 2 91945577 missense probably benign
R8930:Dgkz UTSW 2 91939570 missense probably damaging 0.99
R8932:Dgkz UTSW 2 91939570 missense probably damaging 0.99
RF001:Dgkz UTSW 2 91939941 missense possibly damaging 0.83
X0002:Dgkz UTSW 2 91936562 missense probably damaging 0.97
X0021:Dgkz UTSW 2 91937119 missense possibly damaging 0.91
Z1177:Dgkz UTSW 2 91942334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATACACATGTGGAACCC -3'
(R):5'- AGACCCTTTGACTAGCGGTC -3'

Sequencing Primer
(F):5'- TATGCAGACAGGACAGCTGACTTTC -3'
(R):5'- ACTAGCGGTCAGGAAGGCTTC -3'
Posted On2019-10-24