Mutagenetix > Incidental Mutations

Incidental Mutation 'R7624:Tenm4'

589323

Institutional Source

Beutler Lab

Gene Symbol

Tenm4

Ensembl Gene

ENSMUSG00000048078

Gene Name

teneurin transmembrane protein 4

Synonyms

Doc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7624 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

96171246-96911093 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96895985 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 2440 (M2440V)

Ref Sequence

ENSEMBL: ENSMUSP00000102783 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107162
AA Change: M2432V

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: M2432V

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	410	5.6e-195	PFAM
transmembrane domain	411	433	N/A	INTRINSIC
EGF_like	637	665	3.43e1	SMART
EGF	668	696	2.29e1	SMART
EGF	701	730	1.88e-1	SMART
EGF	733	762	1.13e1	SMART
EGF	767	797	2.39e1	SMART
EGF	800	828	4.32e-1	SMART
EGF	831	859	6.02e0	SMART
EGF	862	894	9.93e-1	SMART
low complexity region	900	914	N/A	INTRINSIC
Pfam:RHS_repeat	2327	2380	5.5e-7	PFAM
Pfam:Tox-GHH	2740	2818	5.2e-34	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107165
AA Change: M2440V

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: M2440V

Domain	Start	End	E-Value	Type
Pfam:Ten_N	36	402	1.1e-171	PFAM
transmembrane domain	403	425	N/A	INTRINSIC
EGF_like	629	657	3.43e1	SMART
EGF	660	688	2.29e1	SMART
EGF	693	722	1.88e-1	SMART
EGF	725	754	1.13e1	SMART
EGF	759	789	2.39e1	SMART
EGF	792	820	4.32e-1	SMART
EGF	823	851	6.02e0	SMART
EGF	863	895	9.93e-1	SMART
low complexity region	901	915	N/A	INTRINSIC
Pfam:RHS_repeat	2335	2368	1.6e-7	PFAM
Pfam:Tox-GHH	2749	2826	1.8e-32	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107166
AA Change: M2403V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: M2403V

Domain	Start	End	E-Value	Type
Pfam:Ten_N	35	193	1.4e-83	PFAM
Pfam:Ten_N	187	365	5e-78	PFAM
transmembrane domain	366	388	N/A	INTRINSIC
EGF_like	592	620	3.43e1	SMART
EGF	623	651	2.29e1	SMART
EGF	656	685	1.88e-1	SMART
EGF	688	717	1.13e1	SMART
EGF	722	752	2.39e1	SMART
EGF	755	783	4.32e-1	SMART
EGF	786	814	6.02e0	SMART
EGF	826	858	9.93e-1	SMART
low complexity region	864	878	N/A	INTRINSIC
Pfam:RHS_repeat	2298	2351	3.8e-7	PFAM
Pfam:Tox-GHH	2711	2789	3.9e-34	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atm	C	A	9: 53,454,768	R2533L	probably damaging	Het
Caprin1	T	A	2: 103,772,677	M514L	possibly damaging	Het
Ccdc78	A	G	17: 25,787,152	E98G	probably damaging	Het
Cmya5	A	T	13: 93,090,357	M2741K	possibly damaging	Het
Cnot1	T	G	8: 95,751,819	R959S	probably damaging	Het
Col12a1	G	T	9: 79,645,794		probably null	Het
Col4a3	A	G	1: 82,718,884	T177A	probably benign	Het
Cpa3	T	C	3: 20,225,143	N211D	possibly damaging	Het
Cryba1	T	C	11: 77,722,717	Y36C	probably damaging	Het
Ctnna1	T	A	18: 35,244,844	I632N	probably benign	Het
D630045J12Rik	T	C	6: 38,149,563	N1504S	probably damaging	Het
Dgkz	C	A	2: 91,942,674	R346L	probably damaging	Het
Dnajc21	G	A	15: 10,461,232	R211C	probably benign	Het
Dnajc21	A	T	15: 10,461,234	I210N	probably damaging	Het
Dscam	T	C	16: 96,610,324	D1784G	probably damaging	Het
Eya3	A	G	4: 132,672,951	T94A	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat3	T	C	9: 15,959,869	D3742G	possibly damaging	Het
Ficd	T	C	5: 113,738,690	F309L	probably benign	Het
Gfra1	A	T	19: 58,238,446	M451K	probably benign	Het
Gm43517	T	A	12: 49,391,178	L318Q		Het
Gsc	A	T	12: 104,473,051	V22E	possibly damaging	Het
Il4ra	T	C	7: 125,569,108	Y100H	probably damaging	Het
Ilf3	T	C	9: 21,398,044	S486P	probably benign	Het
Itga10	T	A	3: 96,652,953	H594Q	probably benign	Het
Kcnf1	T	C	12: 17,176,136	D28G	probably benign	Het
Kiss1	A	G	1: 133,329,422	K53R	possibly damaging	Het
Lcn5	A	G	2: 25,661,414	I182V	probably benign	Het
Lcorl	T	C	5: 45,701,965	D269G	probably benign	Het
Letm2	A	T	8: 25,592,537	C174*	probably null	Het
Met	T	G	6: 17,558,835	V1154G	probably damaging	Het
Mindy3	A	G	2: 12,419,189	S22P	probably benign	Het
Mroh2b	G	A	15: 4,917,131	R471Q	probably damaging	Het
Nfe2l3	T	C	6: 51,458,272	L604P	probably damaging	Het
Olfr1044	A	T	2: 86,171,220	I199N	possibly damaging	Het
Olfr1145	A	G	2: 87,810,339	Q173R	probably damaging	Het
Olfr186	T	A	16: 59,027,019	Q296L	possibly damaging	Het
Olfr294	A	G	7: 86,616,561	F28S	possibly damaging	Het
Olfr824	A	C	10: 130,126,586	I157S	probably damaging	Het
Olfr918	C	T	9: 38,672,623	V274I	probably benign	Het
Pcdha9	T	A	18: 36,999,796	Y639*	probably null	Het
Pom121l2	A	T	13: 21,983,529	I657L	probably damaging	Het
Prr14l	T	A	5: 32,829,623	T843S	possibly damaging	Het
Rln1	A	T	19: 29,332,099	N93K	probably damaging	Het
Rpl3l	A	T	17: 24,732,427	M101L	probably benign	Het
Rtkn	A	G	6: 83,152,177	Y551C	probably benign	Het
Rundc1	G	C	11: 101,433,479	R337P	possibly damaging	Het
Scarf1	T	A	11: 75,514,416		probably null	Het
Serpinb1b	T	A	13: 33,091,639		probably null	Het
Sgsm1	A	T	5: 113,274,335	C484*	probably null	Het
Slc22a19	T	A	19: 7,673,303	K547*	probably null	Het
Slc22a19	T	C	19: 7,693,818	T177A	probably benign	Het
Slc6a5	A	C	7: 49,941,866	K526N	probably benign	Het
Sqle	G	A	15: 59,330,754	R519Q	probably benign	Het
Stard9	T	C	2: 120,688,146	I517T	probably benign	Het
Taf15	A	T	11: 83,505,023	D518V	unknown	Het
Tdgf1	C	T	9: 110,945,949		probably benign	Het
Tm6sf1	A	G	7: 81,868,710	M122V	possibly damaging	Het
Tmprss9	T	A	10: 80,892,219	S548T	possibly damaging	Het
Trim62	A	T	4: 128,883,678		probably benign	Het
Ugt2b34	C	T	5: 86,891,282	V507M	possibly damaging	Het
Usp16	T	A	16: 87,476,805	M423K	probably benign	Het
Vmn1r199	T	A	13: 22,382,736	S67T	probably benign	Het
Vmn1r62	A	T	7: 5,675,601	M94L	probably benign	Het
Wnk4	G	T	11: 101,264,354	E364*	probably null	Het
Xpo1	T	A	11: 23,282,584	I368N	probably damaging	Het
Zfp366	A	G	13: 99,246,296	T656A	probably benign	Het
Zfp934	T	C	13: 62,518,524	M113V	probably benign	Het
Zkscan2	A	G	7: 123,498,771	V134A	probably damaging	Het

Other mutations in Tenm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Tenm4	APN	7	96868009	missense	probably benign	0.00
IGL00468:Tenm4	APN	7	96874472	missense	probably damaging	0.98
IGL00519:Tenm4	APN	7	96805138	splice site	probably benign
IGL00979:Tenm4	APN	7	96729391	missense	probably damaging	0.96
IGL01401:Tenm4	APN	7	96874267	missense	probably damaging	1.00
IGL01459:Tenm4	APN	7	96729385	missense	probably damaging	1.00
IGL01519:Tenm4	APN	7	96895177	missense	probably damaging	1.00
IGL01545:Tenm4	APN	7	96874303	missense	probably benign	0.00
IGL01579:Tenm4	APN	7	96863502	missense	probably benign	0.00
IGL01587:Tenm4	APN	7	96863502	missense	probably benign	0.00
IGL01625:Tenm4	APN	7	96885358	missense	probably damaging	1.00
IGL01655:Tenm4	APN	7	96553724	missense	probably damaging	1.00
IGL01683:Tenm4	APN	7	96885404	missense	possibly damaging	0.84
IGL01728:Tenm4	APN	7	96896064	missense	probably damaging	1.00
IGL01732:Tenm4	APN	7	96895509	missense	probably damaging	1.00
IGL01924:Tenm4	APN	7	96895212	missense	probably damaging	1.00
IGL01966:Tenm4	APN	7	96553550	missense	probably damaging	1.00
IGL02177:Tenm4	APN	7	96895662	missense	probably benign	0.40
IGL02207:Tenm4	APN	7	96874116	missense	possibly damaging	0.85
IGL02269:Tenm4	APN	7	96823822	missense	probably damaging	1.00
IGL02274:Tenm4	APN	7	96854734	missense	probably damaging	1.00
IGL02375:Tenm4	APN	7	96704137	missense	possibly damaging	0.52
IGL02415:Tenm4	APN	7	96874074	missense	probably damaging	0.98
IGL02472:Tenm4	APN	7	96774176	unclassified	probably benign
IGL02656:Tenm4	APN	7	96885433	missense	probably damaging	1.00
IGL02678:Tenm4	APN	7	96896219	missense	probably damaging	1.00
IGL02829:Tenm4	APN	7	96894998	nonsense	probably null
IGL02863:Tenm4	APN	7	96873706	missense	probably damaging	1.00
IGL03145:Tenm4	APN	7	96842968	missense	probably damaging	0.98
IGL03153:Tenm4	APN	7	96873762	missense	probably damaging	1.00
principium	UTSW	7	96797481	missense	probably damaging	0.98
toccata	UTSW	7	96902989	critical splice donor site	probably null
P0026:Tenm4	UTSW	7	96874527	missense	probably damaging	1.00
R0097:Tenm4	UTSW	7	96892926	missense	probably damaging	1.00
R0097:Tenm4	UTSW	7	96892926	missense	probably damaging	1.00
R0140:Tenm4	UTSW	7	96896052	missense	possibly damaging	0.78
R0164:Tenm4	UTSW	7	96729340	splice site	probably benign
R0277:Tenm4	UTSW	7	96694950	missense	possibly damaging	0.54
R0323:Tenm4	UTSW	7	96694950	missense	possibly damaging	0.54
R0362:Tenm4	UTSW	7	96772035	nonsense	probably null
R0381:Tenm4	UTSW	7	96905881	missense	probably damaging	1.00
R0420:Tenm4	UTSW	7	96873766	missense	possibly damaging	0.85
R0426:Tenm4	UTSW	7	96777851	missense	probably damaging	1.00
R0513:Tenm4	UTSW	7	96895623	missense	probably benign	0.35
R0624:Tenm4	UTSW	7	96774020	missense	probably damaging	1.00
R0837:Tenm4	UTSW	7	96896275	splice site	probably benign
R1037:Tenm4	UTSW	7	96797481	missense	probably damaging	0.98
R1172:Tenm4	UTSW	7	96848044	missense	probably damaging	1.00
R1422:Tenm4	UTSW	7	96550051	missense	probably damaging	0.99
R1427:Tenm4	UTSW	7	96843048	missense	probably benign	0.42
R1462:Tenm4	UTSW	7	96704153	missense	probably damaging	1.00
R1462:Tenm4	UTSW	7	96704153	missense	probably damaging	1.00
R1597:Tenm4	UTSW	7	96902989	critical splice donor site	probably null
R1701:Tenm4	UTSW	7	96902889	missense	probably damaging	1.00
R1707:Tenm4	UTSW	7	96888685	missense	probably damaging	1.00
R1809:Tenm4	UTSW	7	96873780	missense	probably benign	0.17
R1812:Tenm4	UTSW	7	96895940	missense	probably damaging	1.00
R1895:Tenm4	UTSW	7	96735808	missense	probably damaging	1.00
R1933:Tenm4	UTSW	7	96895326	missense	probably damaging	1.00
R1946:Tenm4	UTSW	7	96735808	missense	probably damaging	1.00
R2108:Tenm4	UTSW	7	96906290	missense	probably damaging	1.00
R2151:Tenm4	UTSW	7	96902847	missense	probably damaging	1.00
R2247:Tenm4	UTSW	7	96906009	missense	probably benign	0.03
R2329:Tenm4	UTSW	7	96895862	missense	probably benign	0.00
R2893:Tenm4	UTSW	7	96894990	missense	probably damaging	1.00
R2990:Tenm4	UTSW	7	96893125	splice site	probably null
R3409:Tenm4	UTSW	7	96895160	missense	probably damaging	1.00
R3410:Tenm4	UTSW	7	96852530	missense	probably damaging	0.99
R3411:Tenm4	UTSW	7	96852530	missense	probably damaging	0.99
R3440:Tenm4	UTSW	7	96553516	missense	probably benign	0.00
R3441:Tenm4	UTSW	7	96553516	missense	probably benign	0.00
R3719:Tenm4	UTSW	7	96863563	missense	possibly damaging	0.92
R3772:Tenm4	UTSW	7	96694880	missense	probably damaging	1.00
R3773:Tenm4	UTSW	7	96694880	missense	probably damaging	1.00
R4093:Tenm4	UTSW	7	96895772	missense	probably damaging	1.00
R4439:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4441:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4510:Tenm4	UTSW	7	96894863	missense	probably benign
R4511:Tenm4	UTSW	7	96894863	missense	probably benign
R4543:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4645:Tenm4	UTSW	7	96895742	missense	probably damaging	1.00
R4701:Tenm4	UTSW	7	96895349	missense	probably damaging	1.00
R4707:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4714:Tenm4	UTSW	7	96894924	missense	probably damaging	1.00
R4742:Tenm4	UTSW	7	96797484	missense	probably damaging	0.99
R4784:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4785:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4801:Tenm4	UTSW	7	96906245	missense	probably damaging	0.97
R4802:Tenm4	UTSW	7	96906245	missense	probably damaging	0.97
R4880:Tenm4	UTSW	7	96905818	splice site	probably null
R5036:Tenm4	UTSW	7	96694790	missense	probably damaging	1.00
R5036:Tenm4	UTSW	7	96852561	missense	probably damaging	1.00
R5050:Tenm4	UTSW	7	96895788	missense	probably damaging	1.00
R5103:Tenm4	UTSW	7	96842957	missense	probably damaging	1.00
R5106:Tenm4	UTSW	7	96843149	missense	probably damaging	0.99
R5118:Tenm4	UTSW	7	96893086	missense	probably damaging	1.00
R5272:Tenm4	UTSW	7	96874203	missense	probably damaging	0.98
R5282:Tenm4	UTSW	7	96837331	missense	possibly damaging	0.90
R5403:Tenm4	UTSW	7	96888827	missense	probably damaging	1.00
R5404:Tenm4	UTSW	7	96894680	missense	probably damaging	1.00
R5567:Tenm4	UTSW	7	96896209	nonsense	probably null
R5590:Tenm4	UTSW	7	96797400	missense	possibly damaging	0.73
R5590:Tenm4	UTSW	7	96797401	missense	possibly damaging	0.93
R5597:Tenm4	UTSW	7	96553517	missense	probably benign	0.00
R5782:Tenm4	UTSW	7	96893039	missense	probably benign	0.00
R5861:Tenm4	UTSW	7	96843217	intron	probably benign
R5890:Tenm4	UTSW	7	96902860	missense	probably damaging	1.00
R5930:Tenm4	UTSW	7	96854719	missense	probably damaging	1.00
R5940:Tenm4	UTSW	7	96845895	missense	probably damaging	1.00
R6012:Tenm4	UTSW	7	96522433	intron	probably benign
R6060:Tenm4	UTSW	7	96873711	missense	probably damaging	1.00
R6104:Tenm4	UTSW	7	96837289	missense	probably damaging	0.97
R6283:Tenm4	UTSW	7	96874494	missense	probably benign	0.33
R6333:Tenm4	UTSW	7	96774124	missense	probably damaging	1.00
R6522:Tenm4	UTSW	7	96843044	missense	possibly damaging	0.88
R6616:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6746:Tenm4	UTSW	7	96892860	missense	probably damaging	1.00
R6751:Tenm4	UTSW	7	96845712	missense	possibly damaging	0.95
R6806:Tenm4	UTSW	7	96811959	missense	possibly damaging	0.95
R6807:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6807:Tenm4	UTSW	7	96895271	missense	probably damaging	1.00
R6809:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6810:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6811:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6853:Tenm4	UTSW	7	96837295	missense	possibly damaging	0.94
R6886:Tenm4	UTSW	7	96797392	missense	possibly damaging	0.85
R6920:Tenm4	UTSW	7	96895550	missense	probably damaging	1.00
R6937:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6939:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7011:Tenm4	UTSW	7	96896135	nonsense	probably null
R7033:Tenm4	UTSW	7	96895223	nonsense	probably null
R7040:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7083:Tenm4	UTSW	7	96895349	missense	probably damaging	1.00
R7238:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7239:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7239:Tenm4	UTSW	7	96735813	missense	possibly damaging	0.47
R7337:Tenm4	UTSW	7	96874126	missense	probably benign	0.44
R7400:Tenm4	UTSW	7	96694803	missense	probably damaging	0.97
R7407:Tenm4	UTSW	7	96773987	missense	possibly damaging	0.89
R7449:Tenm4	UTSW	7	96874213	missense	possibly damaging	0.65
R7473:Tenm4	UTSW	7	96774146	missense	probably damaging	1.00
R7477:Tenm4	UTSW	7	96845808	missense	probably damaging	0.99
R7489:Tenm4	UTSW	7	96837314	missense	possibly damaging	0.90
R7498:Tenm4	UTSW	7	96848017	missense	probably damaging	1.00
R7562:Tenm4	UTSW	7	96888814	missense	probably damaging	1.00
R7615:Tenm4	UTSW	7	96845926	missense	probably damaging	1.00
R7626:Tenm4	UTSW	7	96893014	missense	probably damaging	1.00
R7690:Tenm4	UTSW	7	96863533	missense	probably benign	0.00
R7692:Tenm4	UTSW	7	96895403	missense	probably damaging	1.00
R7748:Tenm4	UTSW	7	96894702	missense	probably damaging	1.00
R7763:Tenm4	UTSW	7	96895692	missense	probably benign	0.38
R7792:Tenm4	UTSW	7	96774014	missense	possibly damaging	0.54
R7855:Tenm4	UTSW	7	96873874	missense	probably damaging	1.00
R7868:Tenm4	UTSW	7	96906380	missense	possibly damaging	0.79
R7878:Tenm4	UTSW	7	96852357	missense	probably damaging	1.00
R7997:Tenm4	UTSW	7	96874305	missense	probably benign	0.44
R8017:Tenm4	UTSW	7	96704041	missense	probably damaging	1.00
R8019:Tenm4	UTSW	7	96704041	missense	probably damaging	1.00
R8054:Tenm4	UTSW	7	96729346	splice site	probably benign
R8061:Tenm4	UTSW	7	96852456	missense	probably damaging	1.00
R8108:Tenm4	UTSW	7	96854728	missense	probably benign	0.39
R8140:Tenm4	UTSW	7	96895176	missense	probably damaging	1.00
R8214:Tenm4	UTSW	7	96895407	missense	probably damaging	1.00
R8258:Tenm4	UTSW	7	96867991	missense	probably damaging	1.00
R8259:Tenm4	UTSW	7	96867991	missense	probably damaging	1.00
R8364:Tenm4	UTSW	7	96772106	critical splice donor site	probably null
R8542:Tenm4	UTSW	7	96811932	missense	probably damaging	0.99
X0021:Tenm4	UTSW	7	96873909	nonsense	probably null
X0026:Tenm4	UTSW	7	96868087	missense	probably damaging	0.98
X0066:Tenm4	UTSW	7	96848030	missense	probably damaging	1.00
X0066:Tenm4	UTSW	7	96894794	missense	probably damaging	1.00
Z1176:Tenm4	UTSW	7	96905914	missense	probably benign	0.00
Z1177:Tenm4	UTSW	7	96863585	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CACCTGCAGTTCTTCTACGCAG -3'
(R):5'- TGCTACTCAGGCGTTTCCAG -3'

Sequencing Primer
(F):5'- AGTTCTTCTACGCAGACCTGAC -3'
(R):5'- CTCAGGCGTTTCCAGAGTTCATG -3'

Posted On

2019-10-24