Incidental Mutation 'R7624:Olfr918'
ID589330
Institutional Source Beutler Lab
Gene Symbol Olfr918
Ensembl Gene ENSMUSG00000046150
Gene Nameolfactory receptor 918
SynonymsGA_x6K02T2PVTD-32375756-32374818, MOR164-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R7624 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38669861-38674601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38672623 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 274 (V274I)
Ref Sequence ENSEMBL: ENSMUSP00000150182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055099] [ENSMUST00000215461]
Predicted Effect probably benign
Transcript: ENSMUST00000055099
AA Change: V287I

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057210
Gene: ENSMUSG00000046150
AA Change: V287I

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:7tm_4 44 319 6.5e-48 PFAM
Pfam:7tm_1 54 301 3.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215461
AA Change: V274I

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1451 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm C A 9: 53,454,768 R2533L probably damaging Het
Caprin1 T A 2: 103,772,677 M514L possibly damaging Het
Ccdc78 A G 17: 25,787,152 E98G probably damaging Het
Cmya5 A T 13: 93,090,357 M2741K possibly damaging Het
Cnot1 T G 8: 95,751,819 R959S probably damaging Het
Col12a1 G T 9: 79,645,794 probably null Het
Col4a3 A G 1: 82,718,884 T177A probably benign Het
Cpa3 T C 3: 20,225,143 N211D possibly damaging Het
Cryba1 T C 11: 77,722,717 Y36C probably damaging Het
Ctnna1 T A 18: 35,244,844 I632N probably benign Het
D630045J12Rik T C 6: 38,149,563 N1504S probably damaging Het
Dgkz C A 2: 91,942,674 R346L probably damaging Het
Dnajc21 G A 15: 10,461,232 R211C probably benign Het
Dnajc21 A T 15: 10,461,234 I210N probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Eya3 A G 4: 132,672,951 T94A probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T C 9: 15,959,869 D3742G possibly damaging Het
Ficd T C 5: 113,738,690 F309L probably benign Het
Gfra1 A T 19: 58,238,446 M451K probably benign Het
Gm43517 T A 12: 49,391,178 L318Q Het
Gsc A T 12: 104,473,051 V22E possibly damaging Het
Il4ra T C 7: 125,569,108 Y100H probably damaging Het
Ilf3 T C 9: 21,398,044 S486P probably benign Het
Itga10 T A 3: 96,652,953 H594Q probably benign Het
Kcnf1 T C 12: 17,176,136 D28G probably benign Het
Kiss1 A G 1: 133,329,422 K53R possibly damaging Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Lcorl T C 5: 45,701,965 D269G probably benign Het
Letm2 A T 8: 25,592,537 C174* probably null Het
Met T G 6: 17,558,835 V1154G probably damaging Het
Mindy3 A G 2: 12,419,189 S22P probably benign Het
Mroh2b G A 15: 4,917,131 R471Q probably damaging Het
Nfe2l3 T C 6: 51,458,272 L604P probably damaging Het
Olfr1044 A T 2: 86,171,220 I199N possibly damaging Het
Olfr1145 A G 2: 87,810,339 Q173R probably damaging Het
Olfr186 T A 16: 59,027,019 Q296L possibly damaging Het
Olfr294 A G 7: 86,616,561 F28S possibly damaging Het
Olfr824 A C 10: 130,126,586 I157S probably damaging Het
Pcdha9 T A 18: 36,999,796 Y639* probably null Het
Pom121l2 A T 13: 21,983,529 I657L probably damaging Het
Prr14l T A 5: 32,829,623 T843S possibly damaging Het
Rln1 A T 19: 29,332,099 N93K probably damaging Het
Rpl3l A T 17: 24,732,427 M101L probably benign Het
Rtkn A G 6: 83,152,177 Y551C probably benign Het
Rundc1 G C 11: 101,433,479 R337P possibly damaging Het
Scarf1 T A 11: 75,514,416 probably null Het
Serpinb1b T A 13: 33,091,639 probably null Het
Sgsm1 A T 5: 113,274,335 C484* probably null Het
Slc22a19 T A 19: 7,673,303 K547* probably null Het
Slc22a19 T C 19: 7,693,818 T177A probably benign Het
Slc6a5 A C 7: 49,941,866 K526N probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stard9 T C 2: 120,688,146 I517T probably benign Het
Taf15 A T 11: 83,505,023 D518V unknown Het
Tdgf1 C T 9: 110,945,949 probably benign Het
Tenm4 A G 7: 96,895,985 M2440V possibly damaging Het
Tm6sf1 A G 7: 81,868,710 M122V possibly damaging Het
Tmprss9 T A 10: 80,892,219 S548T possibly damaging Het
Trim62 A T 4: 128,883,678 probably benign Het
Ugt2b34 C T 5: 86,891,282 V507M possibly damaging Het
Usp16 T A 16: 87,476,805 M423K probably benign Het
Vmn1r199 T A 13: 22,382,736 S67T probably benign Het
Vmn1r62 A T 7: 5,675,601 M94L probably benign Het
Wnk4 G T 11: 101,264,354 E364* probably null Het
Xpo1 T A 11: 23,282,584 I368N probably damaging Het
Zfp366 A G 13: 99,246,296 T656A probably benign Het
Zfp934 T C 13: 62,518,524 M113V probably benign Het
Zkscan2 A G 7: 123,498,771 V134A probably damaging Het
Other mutations in Olfr918
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr918 APN 9 38673024 missense probably benign 0.01
IGL01388:Olfr918 APN 9 38673083 nonsense probably null
IGL01516:Olfr918 APN 9 38672863 missense probably benign 0.09
IGL02121:Olfr918 APN 9 38673415 missense probably damaging 0.98
IGL02209:Olfr918 APN 9 38673046 missense possibly damaging 0.84
IGL02256:Olfr918 APN 9 38673480 start codon destroyed probably null
IGL02517:Olfr918 APN 9 38672913 missense probably damaging 1.00
IGL02648:Olfr918 APN 9 38673016 missense probably benign
IGL02747:Olfr918 APN 9 38673084 missense probably benign 0.11
IGL02971:Olfr918 APN 9 38673268 missense probably damaging 0.96
E0370:Olfr918 UTSW 9 38672561 missense probably damaging 0.99
R0616:Olfr918 UTSW 9 38673480 start codon destroyed probably null
R2173:Olfr918 UTSW 9 38672944 missense probably benign 0.03
R2989:Olfr918 UTSW 9 38672535 missense probably benign
R3430:Olfr918 UTSW 9 38673139 missense probably damaging 1.00
R3809:Olfr918 UTSW 9 38672863 missense probably benign 0.09
R4688:Olfr918 UTSW 9 38673363 missense probably damaging 1.00
R4702:Olfr918 UTSW 9 38673480 start codon destroyed probably null
R5548:Olfr918 UTSW 9 38673304 missense probably benign 0.00
R5590:Olfr918 UTSW 9 38672965 missense probably damaging 1.00
R6082:Olfr918 UTSW 9 38672570 missense probably damaging 1.00
R6214:Olfr918 UTSW 9 38673214 missense probably benign 0.13
R6215:Olfr918 UTSW 9 38673214 missense probably benign 0.13
R6893:Olfr918 UTSW 9 38673059 missense possibly damaging 0.95
R7215:Olfr918 UTSW 9 38673447 missense probably benign 0.05
R7862:Olfr918 UTSW 9 38673328 missense probably benign 0.01
R7945:Olfr918 UTSW 9 38673328 missense probably benign 0.01
R8116:Olfr918 UTSW 9 38673168 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTGTTGGAAGCAGCAGTAAAGTTG -3'
(R):5'- GTGGGTATTAACATCACAGTCCCC -3'

Sequencing Primer
(F):5'- AGCAGCAGTAAAGTTGAAGAATC -3'
(R):5'- GTATTAACATCACAGTCCCCAGCTTC -3'
Posted On2019-10-24