Incidental Mutation 'R7624:Kcnf1'
ID589340
Institutional Source Beutler Lab
Gene Symbol Kcnf1
Ensembl Gene ENSMUSG00000051726
Gene Namepotassium voltage-gated channel, subfamily F, member 1
SynonymsLOC382571
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R7624 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location17172100-17176888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17176136 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 28 (D28G)
Ref Sequence ENSEMBL: ENSMUSP00000131480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170580]
Predicted Effect probably benign
Transcript: ENSMUST00000170580
AA Change: D28G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131480
Gene: ENSMUSG00000051726
AA Change: D28G

DomainStartEndE-ValueType
BTB 33 147 2.32e-2 SMART
Pfam:Ion_trans 193 429 1.3e-49 PFAM
Pfam:Ion_trans_2 337 423 3.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily F. This gene is intronless and expressed in all tissues tested, including the heart, skeletal muscle, brain, kidney, and pancreas. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm C A 9: 53,454,768 R2533L probably damaging Het
Caprin1 T A 2: 103,772,677 M514L possibly damaging Het
Ccdc78 A G 17: 25,787,152 E98G probably damaging Het
Cmya5 A T 13: 93,090,357 M2741K possibly damaging Het
Cnot1 T G 8: 95,751,819 R959S probably damaging Het
Col12a1 G T 9: 79,645,794 probably null Het
Col4a3 A G 1: 82,718,884 T177A probably benign Het
Cpa3 T C 3: 20,225,143 N211D possibly damaging Het
Cryba1 T C 11: 77,722,717 Y36C probably damaging Het
Ctnna1 T A 18: 35,244,844 I632N probably benign Het
D630045J12Rik T C 6: 38,149,563 N1504S probably damaging Het
Dgkz C A 2: 91,942,674 R346L probably damaging Het
Dnajc21 G A 15: 10,461,232 R211C probably benign Het
Dnajc21 A T 15: 10,461,234 I210N probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Eya3 A G 4: 132,672,951 T94A probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T C 9: 15,959,869 D3742G possibly damaging Het
Ficd T C 5: 113,738,690 F309L probably benign Het
Gfra1 A T 19: 58,238,446 M451K probably benign Het
Gm43517 T A 12: 49,391,178 L318Q Het
Gsc A T 12: 104,473,051 V22E possibly damaging Het
Il4ra T C 7: 125,569,108 Y100H probably damaging Het
Ilf3 T C 9: 21,398,044 S486P probably benign Het
Itga10 T A 3: 96,652,953 H594Q probably benign Het
Kiss1 A G 1: 133,329,422 K53R possibly damaging Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Lcorl T C 5: 45,701,965 D269G probably benign Het
Letm2 A T 8: 25,592,537 C174* probably null Het
Met T G 6: 17,558,835 V1154G probably damaging Het
Mindy3 A G 2: 12,419,189 S22P probably benign Het
Mroh2b G A 15: 4,917,131 R471Q probably damaging Het
Nfe2l3 T C 6: 51,458,272 L604P probably damaging Het
Olfr1044 A T 2: 86,171,220 I199N possibly damaging Het
Olfr1145 A G 2: 87,810,339 Q173R probably damaging Het
Olfr186 T A 16: 59,027,019 Q296L possibly damaging Het
Olfr294 A G 7: 86,616,561 F28S possibly damaging Het
Olfr824 A C 10: 130,126,586 I157S probably damaging Het
Olfr918 C T 9: 38,672,623 V274I probably benign Het
Pcdha9 T A 18: 36,999,796 Y639* probably null Het
Pom121l2 A T 13: 21,983,529 I657L probably damaging Het
Prr14l T A 5: 32,829,623 T843S possibly damaging Het
Rln1 A T 19: 29,332,099 N93K probably damaging Het
Rpl3l A T 17: 24,732,427 M101L probably benign Het
Rtkn A G 6: 83,152,177 Y551C probably benign Het
Rundc1 G C 11: 101,433,479 R337P possibly damaging Het
Scarf1 T A 11: 75,514,416 probably null Het
Serpinb1b T A 13: 33,091,639 probably null Het
Sgsm1 A T 5: 113,274,335 C484* probably null Het
Slc22a19 T A 19: 7,673,303 K547* probably null Het
Slc22a19 T C 19: 7,693,818 T177A probably benign Het
Slc6a5 A C 7: 49,941,866 K526N probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stard9 T C 2: 120,688,146 I517T probably benign Het
Taf15 A T 11: 83,505,023 D518V unknown Het
Tdgf1 C T 9: 110,945,949 probably benign Het
Tenm4 A G 7: 96,895,985 M2440V possibly damaging Het
Tm6sf1 A G 7: 81,868,710 M122V possibly damaging Het
Tmprss9 T A 10: 80,892,219 S548T possibly damaging Het
Trim62 A T 4: 128,883,678 probably benign Het
Ugt2b34 C T 5: 86,891,282 V507M possibly damaging Het
Usp16 T A 16: 87,476,805 M423K probably benign Het
Vmn1r199 T A 13: 22,382,736 S67T probably benign Het
Vmn1r62 A T 7: 5,675,601 M94L probably benign Het
Wnk4 G T 11: 101,264,354 E364* probably null Het
Xpo1 T A 11: 23,282,584 I368N probably damaging Het
Zfp366 A G 13: 99,246,296 T656A probably benign Het
Zfp934 T C 13: 62,518,524 M113V probably benign Het
Zkscan2 A G 7: 123,498,771 V134A probably damaging Het
Other mutations in Kcnf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Kcnf1 APN 12 17175348 missense probably benign 0.00
IGL02586:Kcnf1 APN 12 17176143 missense probably benign 0.27
R0931:Kcnf1 UTSW 12 17175141 missense possibly damaging 0.89
R1068:Kcnf1 UTSW 12 17175474 missense probably damaging 1.00
R1558:Kcnf1 UTSW 12 17175473 missense probably damaging 1.00
R1571:Kcnf1 UTSW 12 17175852 missense probably benign 0.00
R1607:Kcnf1 UTSW 12 17175732 missense probably benign 0.26
R2471:Kcnf1 UTSW 12 17175530 missense probably damaging 1.00
R4013:Kcnf1 UTSW 12 17175993 missense probably benign 0.01
R4095:Kcnf1 UTSW 12 17175479 missense possibly damaging 0.92
R4980:Kcnf1 UTSW 12 17175011 missense possibly damaging 0.88
R5157:Kcnf1 UTSW 12 17174741 missense probably benign
R6017:Kcnf1 UTSW 12 17175081 missense probably damaging 0.97
R7130:Kcnf1 UTSW 12 17175809 missense probably benign 0.27
R7225:Kcnf1 UTSW 12 17175693 missense possibly damaging 0.47
R7308:Kcnf1 UTSW 12 17174729 missense probably benign 0.13
R7614:Kcnf1 UTSW 12 17174786 missense probably benign 0.03
R8510:Kcnf1 UTSW 12 17175938 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCGTAATCGTCGCACAGAG -3'
(R):5'- AGAAGAACCAAGTCCTGTCCCG -3'

Sequencing Primer
(F):5'- GAGAAGATGGTGTCGTAGCCCC -3'
(R):5'- ACTGGGTGCATGGCTCC -3'
Posted On2019-10-24