Mutagenetix > Incidental Mutation

Incidental Mutation 'R7624:Cmya5'

589346

Institutional Source

Beutler Lab

Gene Symbol

Cmya5

Ensembl Gene

ENSMUSG00000047419

Gene Name

cardiomyopathy associated 5

Synonyms

Myospryn, 2310076E21Rik, 2310076E16Rik

MMRRC Submission

045689-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.326) question?

Stock #

R7624 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93040713-93144724 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 93090357 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 2741 (M2741K)

Ref Sequence

ENSEMBL: ENSMUSP00000050408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062122]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062122
AA Change: M2741K

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: M2741K

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
low complexity region	129	140	N/A	INTRINSIC
internal_repeat_1	448	535	5.09e-18	PROSPERO
internal_repeat_1	543	625	5.09e-18	PROSPERO
low complexity region	626	645	N/A	INTRINSIC
low complexity region	679	691	N/A	INTRINSIC
low complexity region	734	741	N/A	INTRINSIC
low complexity region	1001	1010	N/A	INTRINSIC
low complexity region	1166	1183	N/A	INTRINSIC
low complexity region	1259	1267	N/A	INTRINSIC
low complexity region	1440	1449	N/A	INTRINSIC
low complexity region	1876	1889	N/A	INTRINSIC
low complexity region	2632	2645	N/A	INTRINSIC
low complexity region	3048	3057	N/A	INTRINSIC
FN3	3312	3399	7.29e-4	SMART
FN3	3411	3492	1.3e0	SMART
Pfam:SPRY	3551	3668	6.7e-8	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

99% (69/70)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atm	C	A	9: 53,454,768	R2533L	probably damaging	Het
Caprin1	T	A	2: 103,772,677	M514L	possibly damaging	Het
Ccdc78	A	G	17: 25,787,152	E98G	probably damaging	Het
Cnot1	T	G	8: 95,751,819	R959S	probably damaging	Het
Col12a1	G	T	9: 79,645,794		probably null	Het
Col4a3	A	G	1: 82,718,884	T177A	probably benign	Het
Cpa3	T	C	3: 20,225,143	N211D	possibly damaging	Het
Cryba1	T	C	11: 77,722,717	Y36C	probably damaging	Het
Ctnna1	T	A	18: 35,244,844	I632N	probably benign	Het
D630045J12Rik	T	C	6: 38,149,563	N1504S	probably damaging	Het
Dgkz	C	A	2: 91,942,674	R346L	probably damaging	Het
Dnajc21	G	A	15: 10,461,232	R211C	probably benign	Het
Dnajc21	A	T	15: 10,461,234	I210N	probably damaging	Het
Dscam	T	C	16: 96,610,324	D1784G	probably damaging	Het
Eya3	A	G	4: 132,672,951	T94A	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat3	T	C	9: 15,959,869	D3742G	possibly damaging	Het
Ficd	T	C	5: 113,738,690	F309L	probably benign	Het
Gfra1	A	T	19: 58,238,446	M451K	probably benign	Het
Gm43517	T	A	12: 49,391,178	L318Q		Het
Gsc	A	T	12: 104,473,051	V22E	possibly damaging	Het
Il4ra	T	C	7: 125,569,108	Y100H	probably damaging	Het
Ilf3	T	C	9: 21,398,044	S486P	probably benign	Het
Itga10	T	A	3: 96,652,953	H594Q	probably benign	Het
Kcnf1	T	C	12: 17,176,136	D28G	probably benign	Het
Kiss1	A	G	1: 133,329,422	K53R	possibly damaging	Het
Lcn5	A	G	2: 25,661,414	I182V	probably benign	Het
Lcorl	T	C	5: 45,701,965	D269G	probably benign	Het
Letm2	A	T	8: 25,592,537	C174*	probably null	Het
Met	T	G	6: 17,558,835	V1154G	probably damaging	Het
Mindy3	A	G	2: 12,419,189	S22P	probably benign	Het
Mroh2b	G	A	15: 4,917,131	R471Q	probably damaging	Het
Nfe2l3	T	C	6: 51,458,272	L604P	probably damaging	Het
Olfr1044	A	T	2: 86,171,220	I199N	possibly damaging	Het
Olfr1145	A	G	2: 87,810,339	Q173R	probably damaging	Het
Olfr186	T	A	16: 59,027,019	Q296L	possibly damaging	Het
Olfr294	A	G	7: 86,616,561	F28S	possibly damaging	Het
Olfr824	A	C	10: 130,126,586	I157S	probably damaging	Het
Olfr918	C	T	9: 38,672,623	V274I	probably benign	Het
Pcdha9	T	A	18: 36,999,796	Y639*	probably null	Het
Pom121l2	A	T	13: 21,983,529	I657L	probably damaging	Het
Prr14l	T	A	5: 32,829,623	T843S	possibly damaging	Het
Rln1	A	T	19: 29,332,099	N93K	probably damaging	Het
Rpl3l	A	T	17: 24,732,427	M101L	probably benign	Het
Rtkn	A	G	6: 83,152,177	Y551C	probably benign	Het
Rundc1	G	C	11: 101,433,479	R337P	possibly damaging	Het
Scarf1	T	A	11: 75,514,416		probably null	Het
Serpinb1b	T	A	13: 33,091,639		probably null	Het
Sgsm1	A	T	5: 113,274,335	C484*	probably null	Het
Slc22a19	T	A	19: 7,673,303	K547*	probably null	Het
Slc22a19	T	C	19: 7,693,818	T177A	probably benign	Het
Slc6a5	A	C	7: 49,941,866	K526N	probably benign	Het
Sqle	G	A	15: 59,330,754	R519Q	probably benign	Het
Stard9	T	C	2: 120,688,146	I517T	probably benign	Het
Taf15	A	T	11: 83,505,023	D518V	unknown	Het
Tdgf1	C	T	9: 110,945,949		probably benign	Het
Tenm4	A	G	7: 96,895,985	M2440V	possibly damaging	Het
Tm6sf1	A	G	7: 81,868,710	M122V	possibly damaging	Het
Tmprss9	T	A	10: 80,892,219	S548T	possibly damaging	Het
Trim62	A	T	4: 128,883,678		probably benign	Het
Ugt2b34	C	T	5: 86,891,282	V507M	possibly damaging	Het
Usp16	T	A	16: 87,476,805	M423K	probably benign	Het
Vmn1r199	T	A	13: 22,382,736	S67T	probably benign	Het
Vmn1r62	A	T	7: 5,675,601	M94L	probably benign	Het
Wnk4	G	T	11: 101,264,354	E364*	probably null	Het
Xpo1	T	A	11: 23,282,584	I368N	probably damaging	Het
Zfp366	A	G	13: 99,246,296	T656A	probably benign	Het
Zfp934	T	C	13: 62,518,524	M113V	probably benign	Het
Zkscan2	A	G	7: 123,498,771	V134A	probably damaging	Het

Other mutations in Cmya5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Cmya5	APN	13	93093120	missense	probably benign	0.13
IGL00516:Cmya5	APN	13	93098167	missense	possibly damaging	0.73
IGL00654:Cmya5	APN	13	93094161	missense	probably benign	0.00
IGL00948:Cmya5	APN	13	93091036	missense	probably benign
IGL00966:Cmya5	APN	13	93097906	missense	probably benign	0.33
IGL00988:Cmya5	APN	13	93097933	missense	possibly damaging	0.96
IGL01106:Cmya5	APN	13	93084612	missense	probably damaging	1.00
IGL01331:Cmya5	APN	13	93096946	missense	possibly damaging	0.53
IGL01392:Cmya5	APN	13	93089206	missense	probably damaging	0.99
IGL01508:Cmya5	APN	13	93094027	missense	probably benign
IGL01679:Cmya5	APN	13	93065320	missense	probably damaging	1.00
IGL01749:Cmya5	APN	13	93089299	missense	probably benign	0.00
IGL01861:Cmya5	APN	13	93089748	missense	probably damaging	1.00
IGL02021:Cmya5	APN	13	93094549	missense	probably benign	0.00
IGL02034:Cmya5	APN	13	93084535	splice site	probably benign
IGL02103:Cmya5	APN	13	93092127	missense	probably benign	0.05
IGL02174:Cmya5	APN	13	93048907	missense	possibly damaging	0.76
IGL02176:Cmya5	APN	13	93090150	missense	probably damaging	1.00
IGL02210:Cmya5	APN	13	93092734	missense	probably benign	0.14
IGL02229:Cmya5	APN	13	93092686	missense	possibly damaging	0.54
IGL02306:Cmya5	APN	13	93098019	missense	probably damaging	1.00
IGL02311:Cmya5	APN	13	93090655	missense	probably benign	0.40
IGL02409:Cmya5	APN	13	93090198	missense	probably damaging	0.96
IGL02561:Cmya5	APN	13	93091858	missense	probably benign	0.00
IGL02676:Cmya5	APN	13	93092853	missense	probably damaging	1.00
IGL02683:Cmya5	APN	13	93090997	nonsense	probably null
IGL02685:Cmya5	APN	13	93090997	nonsense	probably null
IGL02686:Cmya5	APN	13	93090997	nonsense	probably null
IGL02724:Cmya5	APN	13	93096655	missense	probably benign
IGL02727:Cmya5	APN	13	93098245	missense	possibly damaging	0.73
IGL02965:Cmya5	APN	13	93092557	missense	probably benign	0.41
IGL03079:Cmya5	APN	13	93097701	missense	possibly damaging	0.85
IGL03144:Cmya5	APN	13	93090868	missense	probably damaging	1.00
IGL03253:Cmya5	APN	13	93091270	nonsense	probably null
IGL03336:Cmya5	APN	13	93093505	missense	possibly damaging	0.84
IGL03138:Cmya5	UTSW	13	93065342	missense	probably damaging	1.00
P0023:Cmya5	UTSW	13	93089346	missense	probably benign	0.22
P4748:Cmya5	UTSW	13	93074475	splice site	probably benign
R0123:Cmya5	UTSW	13	93095904	missense	possibly damaging	0.84
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0331:Cmya5	UTSW	13	93144403	missense	possibly damaging	0.53
R0363:Cmya5	UTSW	13	93094869	missense	possibly damaging	0.77
R0382:Cmya5	UTSW	13	93092748	missense	probably benign	0.06
R0416:Cmya5	UTSW	13	93089856	missense	probably benign	0.05
R0446:Cmya5	UTSW	13	93093656	missense	probably benign
R0457:Cmya5	UTSW	13	93095587	missense	possibly damaging	0.84
R0673:Cmya5	UTSW	13	93089997	missense	probably damaging	1.00
R0674:Cmya5	UTSW	13	93092791	missense	probably damaging	1.00
R0692:Cmya5	UTSW	13	93093849	nonsense	probably null
R0698:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R1227:Cmya5	UTSW	13	93094446	missense	probably damaging	0.99
R1272:Cmya5	UTSW	13	93095112	missense	possibly damaging	0.79
R1335:Cmya5	UTSW	13	93041535	missense	possibly damaging	0.65
R1353:Cmya5	UTSW	13	93041525	missense	probably damaging	1.00
R1354:Cmya5	UTSW	13	93092058	missense	possibly damaging	0.46
R1458:Cmya5	UTSW	13	93065327	missense	probably benign	0.44
R1572:Cmya5	UTSW	13	93094269	missense	possibly damaging	0.61
R1698:Cmya5	UTSW	13	93063519	missense	probably benign	0.27
R1735:Cmya5	UTSW	13	93089789	missense	probably benign	0.11
R1743:Cmya5	UTSW	13	93097317	missense	probably benign	0.33
R1750:Cmya5	UTSW	13	93095663	missense	probably benign
R1827:Cmya5	UTSW	13	93074448	missense	possibly damaging	0.80
R2068:Cmya5	UTSW	13	93090524	missense	possibly damaging	0.93
R2088:Cmya5	UTSW	13	93092812	missense	probably damaging	1.00
R2132:Cmya5	UTSW	13	93069383	missense	probably damaging	1.00
R2216:Cmya5	UTSW	13	93093495	missense	probably damaging	1.00
R2363:Cmya5	UTSW	13	93093702	missense	probably benign	0.15
R2497:Cmya5	UTSW	13	93098005	missense	possibly damaging	0.53
R2509:Cmya5	UTSW	13	93093558	missense	probably benign	0.41
R2917:Cmya5	UTSW	13	93091064	nonsense	probably null
R2944:Cmya5	UTSW	13	93092842	nonsense	probably null
R3039:Cmya5	UTSW	13	93092250	missense	probably benign	0.12
R3078:Cmya5	UTSW	13	93048927	missense	probably damaging	0.99
R3708:Cmya5	UTSW	13	93095366	nonsense	probably null
R3717:Cmya5	UTSW	13	93092487	missense	probably benign	0.12
R3768:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3769:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3840:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3841:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3882:Cmya5	UTSW	13	93091219	missense	probably benign	0.07
R3888:Cmya5	UTSW	13	93093656	missense	probably benign
R3897:Cmya5	UTSW	13	93096681	missense	possibly damaging	0.72
R3952:Cmya5	UTSW	13	93089199	missense	possibly damaging	0.89
R4366:Cmya5	UTSW	13	93091956	missense	probably benign	0.36
R4471:Cmya5	UTSW	13	93092325	missense	probably benign	0.01
R4493:Cmya5	UTSW	13	93094065	missense	probably benign
R4495:Cmya5	UTSW	13	93094065	missense	probably benign
R4544:Cmya5	UTSW	13	93091918	nonsense	probably null
R4545:Cmya5	UTSW	13	93091918	nonsense	probably null
R4624:Cmya5	UTSW	13	93063551	missense	probably damaging	1.00
R4648:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R4824:Cmya5	UTSW	13	93093574	missense	probably benign	0.04
R4965:Cmya5	UTSW	13	93095787	missense	possibly damaging	0.84
R4967:Cmya5	UTSW	13	93090585	missense	probably damaging	1.00
R5101:Cmya5	UTSW	13	93091603	missense	possibly damaging	0.61
R5133:Cmya5	UTSW	13	93093372	missense	possibly damaging	0.79
R5139:Cmya5	UTSW	13	93096061	missense	probably benign	0.00
R5220:Cmya5	UTSW	13	93092296	missense	probably damaging	0.99
R5332:Cmya5	UTSW	13	93096195	missense	probably damaging	0.96
R5337:Cmya5	UTSW	13	93083273	missense	probably benign	0.28
R5356:Cmya5	UTSW	13	93063485	missense	probably damaging	1.00
R5401:Cmya5	UTSW	13	93091968	missense	probably damaging	1.00
R5438:Cmya5	UTSW	13	93095199	missense	possibly damaging	0.89
R5604:Cmya5	UTSW	13	93092763	missense	probably benign	0.15
R5628:Cmya5	UTSW	13	93089710	missense	probably damaging	1.00
R5666:Cmya5	UTSW	13	93045949	missense	possibly damaging	0.75
R5687:Cmya5	UTSW	13	93098176	missense	possibly damaging	0.53
R5695:Cmya5	UTSW	13	93045866	critical splice donor site	probably null
R5806:Cmya5	UTSW	13	93093937	missense	possibly damaging	0.84
R5820:Cmya5	UTSW	13	93092780	missense	probably benign	0.04
R5872:Cmya5	UTSW	13	93097435	missense	probably benign	0.01
R5875:Cmya5	UTSW	13	93095184	missense	probably benign	0.13
R5896:Cmya5	UTSW	13	93045865	critical splice donor site	probably null
R5910:Cmya5	UTSW	13	93092643	missense	probably damaging	0.98
R5969:Cmya5	UTSW	13	93089544	missense	possibly damaging	0.78
R6064:Cmya5	UTSW	13	93089649	missense	probably damaging	1.00
R6081:Cmya5	UTSW	13	93144513	unclassified	probably benign
R6102:Cmya5	UTSW	13	93094231	missense	probably benign
R6117:Cmya5	UTSW	13	93095166	missense	probably damaging	0.98
R6188:Cmya5	UTSW	13	93093444	missense	possibly damaging	0.61
R6188:Cmya5	UTSW	13	93097276	missense	possibly damaging	0.73
R6219:Cmya5	UTSW	13	93094443	missense	probably damaging	1.00
R6229:Cmya5	UTSW	13	93093306	missense	probably benign	0.41
R6346:Cmya5	UTSW	13	93092190	missense	probably damaging	1.00
R6431:Cmya5	UTSW	13	93074464	missense	possibly damaging	0.60
R6436:Cmya5	UTSW	13	93089215	missense	probably damaging	0.98
R6598:Cmya5	UTSW	13	93089808	missense	probably benign	0.05
R6649:Cmya5	UTSW	13	93098025	missense	possibly damaging	0.91
R6652:Cmya5	UTSW	13	93092895	missense	probably benign	0.04
R6652:Cmya5	UTSW	13	93093039	missense	probably damaging	0.99
R6669:Cmya5	UTSW	13	93093259	missense	probably benign	0.03
R6881:Cmya5	UTSW	13	93090292	missense	probably damaging	1.00
R6909:Cmya5	UTSW	13	93091252	missense	probably benign	0.04
R6933:Cmya5	UTSW	13	93095136	missense	probably benign	0.03
R7021:Cmya5	UTSW	13	93093555	missense	possibly damaging	0.62
R7022:Cmya5	UTSW	13	93069278	critical splice donor site	probably null
R7068:Cmya5	UTSW	13	93092697	missense	possibly damaging	0.59
R7087:Cmya5	UTSW	13	93090975	missense	probably benign	0.00
R7088:Cmya5	UTSW	13	93091864	missense	possibly damaging	0.95
R7126:Cmya5	UTSW	13	93089940	missense	probably benign	0.41
R7177:Cmya5	UTSW	13	93095328	missense	probably benign	0.00
R7188:Cmya5	UTSW	13	93046038	missense	probably damaging	1.00
R7217:Cmya5	UTSW	13	93090430	missense	probably damaging	1.00
R7278:Cmya5	UTSW	13	93095700	missense	probably damaging	0.96
R7293:Cmya5	UTSW	13	93092797	missense	possibly damaging	0.90
R7332:Cmya5	UTSW	13	93092553	missense	possibly damaging	0.60
R7375:Cmya5	UTSW	13	93091661	missense	probably damaging	0.97
R7386:Cmya5	UTSW	13	93069323	missense	probably damaging	1.00
R7489:Cmya5	UTSW	13	93091838	missense	possibly damaging	0.87
R7529:Cmya5	UTSW	13	93097434	missense	probably benign	0.02
R7552:Cmya5	UTSW	13	93069312	missense	probably benign	0.41
R7637:Cmya5	UTSW	13	93083212	missense	possibly damaging	0.87
R7673:Cmya5	UTSW	13	93094121	missense	probably benign	0.13
R7753:Cmya5	UTSW	13	93098172	missense	probably benign	0.18
R7757:Cmya5	UTSW	13	93098272	missense	possibly damaging	0.53
R7806:Cmya5	UTSW	13	93094262	missense	probably benign	0.00
R7825:Cmya5	UTSW	13	93097628	missense	possibly damaging	0.53
R7878:Cmya5	UTSW	13	93089757	missense	probably damaging	0.98
R7892:Cmya5	UTSW	13	93096357	missense	probably damaging	0.96
R7952:Cmya5	UTSW	13	93097004	small deletion	probably benign
R8127:Cmya5	UTSW	13	93094614	missense	probably damaging	0.99
R8256:Cmya5	UTSW	13	93093478	missense	possibly damaging	0.62
R8339:Cmya5	UTSW	13	93091634	nonsense	probably null
R8446:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R8553:Cmya5	UTSW	13	93093796	missense	probably benign	0.00
R8686:Cmya5	UTSW	13	93095380	missense	possibly damaging	0.91
R8748:Cmya5	UTSW	13	93089721	missense	probably damaging	1.00
R8783:Cmya5	UTSW	13	93089380	missense	possibly damaging	0.58
R8803:Cmya5	UTSW	13	93041483	missense	probably damaging	1.00
R8810:Cmya5	UTSW	13	93063540	missense	possibly damaging	0.47
R8937:Cmya5	UTSW	13	93096332	missense	probably benign	0.01
R8985:Cmya5	UTSW	13	93097156	missense	possibly damaging	0.73
R9017:Cmya5	UTSW	13	93092064	missense	probably benign	0.03
R9087:Cmya5	UTSW	13	93097203	missense	possibly damaging	0.72
R9133:Cmya5	UTSW	13	93097600	missense	possibly damaging	0.73
R9156:Cmya5	UTSW	13	93097370	missense	unknown
R9209:Cmya5	UTSW	13	93090358	missense	probably benign	0.45
R9222:Cmya5	UTSW	13	93094071	missense	probably benign	0.00
R9229:Cmya5	UTSW	13	93095668	missense	possibly damaging	0.92
R9382:Cmya5	UTSW	13	93093376	missense	probably benign
R9385:Cmya5	UTSW	13	93094372	missense	probably damaging	0.99
R9418:Cmya5	UTSW	13	93089701	missense	probably benign	0.22
R9452:Cmya5	UTSW	13	93095886	missense	probably benign
R9492:Cmya5	UTSW	13	93041314	makesense	probably null
R9600:Cmya5	UTSW	13	93090096	missense	probably damaging	1.00
R9712:Cmya5	UTSW	13	93065373	critical splice acceptor site	probably null
R9742:Cmya5	UTSW	13	93095427	missense	possibly damaging	0.89
RF020:Cmya5	UTSW	13	93069291	missense	possibly damaging	0.56
X0028:Cmya5	UTSW	13	93096687	missense	possibly damaging	0.53
Z1088:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93096790	missense	unknown
Z1177:Cmya5	UTSW	13	93063579	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTAGCAGCTCAGGGTTGACAG -3'
(R):5'- CCACAGTTTCTGGTGAAGAGG -3'

Sequencing Primer
(F):5'- GTTGACAGCCTTGGGGG -3'
(R):5'- GATTGATTATAACCTCTCCCCAGG -3'

Posted On

2019-10-24