Incidental Mutation 'R7624:Mroh2b'
ID589348
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7624 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4917131 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 471 (R471Q)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably damaging
Transcript: ENSMUST00000045736
AA Change: R471Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: R471Q

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm C A 9: 53,454,768 R2533L probably damaging Het
Caprin1 T A 2: 103,772,677 M514L possibly damaging Het
Ccdc78 A G 17: 25,787,152 E98G probably damaging Het
Cmya5 A T 13: 93,090,357 M2741K possibly damaging Het
Cnot1 T G 8: 95,751,819 R959S probably damaging Het
Col12a1 G T 9: 79,645,794 probably null Het
Col4a3 A G 1: 82,718,884 T177A probably benign Het
Cpa3 T C 3: 20,225,143 N211D possibly damaging Het
Cryba1 T C 11: 77,722,717 Y36C probably damaging Het
Ctnna1 T A 18: 35,244,844 I632N probably benign Het
D630045J12Rik T C 6: 38,149,563 N1504S probably damaging Het
Dgkz C A 2: 91,942,674 R346L probably damaging Het
Dnajc21 A T 15: 10,461,234 I210N probably damaging Het
Dnajc21 G A 15: 10,461,232 R211C probably benign Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Eya3 A G 4: 132,672,951 T94A probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T C 9: 15,959,869 D3742G possibly damaging Het
Ficd T C 5: 113,738,690 F309L probably benign Het
Gfra1 A T 19: 58,238,446 M451K probably benign Het
Gm43517 T A 12: 49,391,178 L318Q Het
Gsc A T 12: 104,473,051 V22E possibly damaging Het
Il4ra T C 7: 125,569,108 Y100H probably damaging Het
Ilf3 T C 9: 21,398,044 S486P probably benign Het
Itga10 T A 3: 96,652,953 H594Q probably benign Het
Kcnf1 T C 12: 17,176,136 D28G probably benign Het
Kiss1 A G 1: 133,329,422 K53R possibly damaging Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Lcorl T C 5: 45,701,965 D269G probably benign Het
Letm2 A T 8: 25,592,537 C174* probably null Het
Met T G 6: 17,558,835 V1154G probably damaging Het
Mindy3 A G 2: 12,419,189 S22P probably benign Het
Nfe2l3 T C 6: 51,458,272 L604P probably damaging Het
Olfr1044 A T 2: 86,171,220 I199N possibly damaging Het
Olfr1145 A G 2: 87,810,339 Q173R probably damaging Het
Olfr186 T A 16: 59,027,019 Q296L possibly damaging Het
Olfr294 A G 7: 86,616,561 F28S possibly damaging Het
Olfr824 A C 10: 130,126,586 I157S probably damaging Het
Olfr918 C T 9: 38,672,623 V274I probably benign Het
Pcdha9 T A 18: 36,999,796 Y639* probably null Het
Pom121l2 A T 13: 21,983,529 I657L probably damaging Het
Prr14l T A 5: 32,829,623 T843S possibly damaging Het
Rln1 A T 19: 29,332,099 N93K probably damaging Het
Rpl3l A T 17: 24,732,427 M101L probably benign Het
Rtkn A G 6: 83,152,177 Y551C probably benign Het
Rundc1 G C 11: 101,433,479 R337P possibly damaging Het
Scarf1 T A 11: 75,514,416 probably null Het
Serpinb1b T A 13: 33,091,639 probably null Het
Sgsm1 A T 5: 113,274,335 C484* probably null Het
Slc22a19 T A 19: 7,673,303 K547* probably null Het
Slc22a19 T C 19: 7,693,818 T177A probably benign Het
Slc6a5 A C 7: 49,941,866 K526N probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stard9 T C 2: 120,688,146 I517T probably benign Het
Taf15 A T 11: 83,505,023 D518V unknown Het
Tdgf1 C T 9: 110,945,949 probably benign Het
Tenm4 A G 7: 96,895,985 M2440V possibly damaging Het
Tm6sf1 A G 7: 81,868,710 M122V possibly damaging Het
Tmprss9 T A 10: 80,892,219 S548T possibly damaging Het
Trim62 A T 4: 128,883,678 probably benign Het
Ugt2b34 C T 5: 86,891,282 V507M possibly damaging Het
Usp16 T A 16: 87,476,805 M423K probably benign Het
Vmn1r199 T A 13: 22,382,736 S67T probably benign Het
Vmn1r62 A T 7: 5,675,601 M94L probably benign Het
Wnk4 G T 11: 101,264,354 E364* probably null Het
Xpo1 T A 11: 23,282,584 I368N probably damaging Het
Zfp366 A G 13: 99,246,296 T656A probably benign Het
Zfp934 T C 13: 62,518,524 M113V probably benign Het
Zkscan2 A G 7: 123,498,771 V134A probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTTGACACAACCTGAAAACTG -3'
(R):5'- CCCGGGGAAAATTCAGACTG -3'

Sequencing Primer
(F):5'- TACTGACACACAAAAGAGGAGATTC -3'
(R):5'- ATTCAGACTGGGGGCAGGTATG -3'
Posted On2019-10-24