Incidental Mutation 'R7624:Dscam'
ID 589354
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene Name DS cell adhesion molecule
Synonyms 4932410A21Rik
MMRRC Submission
Accession Numbers

Genbank: NM_031174; MGI: 1196281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7624 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 96592079-97170752 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96610324 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1784 (D1784G)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
AlphaFold Q9ERC8
Predicted Effect probably damaging
Transcript: ENSMUST00000056102
AA Change: D1784G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: D1784G

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype Strain: 4830358; 3840666;5305025;3761008
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm C A 9: 53,454,768 R2533L probably damaging Het
Caprin1 T A 2: 103,772,677 M514L possibly damaging Het
Ccdc78 A G 17: 25,787,152 E98G probably damaging Het
Cmya5 A T 13: 93,090,357 M2741K possibly damaging Het
Cnot1 T G 8: 95,751,819 R959S probably damaging Het
Col12a1 G T 9: 79,645,794 probably null Het
Col4a3 A G 1: 82,718,884 T177A probably benign Het
Cpa3 T C 3: 20,225,143 N211D possibly damaging Het
Cryba1 T C 11: 77,722,717 Y36C probably damaging Het
Ctnna1 T A 18: 35,244,844 I632N probably benign Het
D630045J12Rik T C 6: 38,149,563 N1504S probably damaging Het
Dgkz C A 2: 91,942,674 R346L probably damaging Het
Dnajc21 G A 15: 10,461,232 R211C probably benign Het
Dnajc21 A T 15: 10,461,234 I210N probably damaging Het
Eya3 A G 4: 132,672,951 T94A probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T C 9: 15,959,869 D3742G possibly damaging Het
Ficd T C 5: 113,738,690 F309L probably benign Het
Gfra1 A T 19: 58,238,446 M451K probably benign Het
Gm43517 T A 12: 49,391,178 L318Q Het
Gsc A T 12: 104,473,051 V22E possibly damaging Het
Il4ra T C 7: 125,569,108 Y100H probably damaging Het
Ilf3 T C 9: 21,398,044 S486P probably benign Het
Itga10 T A 3: 96,652,953 H594Q probably benign Het
Kcnf1 T C 12: 17,176,136 D28G probably benign Het
Kiss1 A G 1: 133,329,422 K53R possibly damaging Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Lcorl T C 5: 45,701,965 D269G probably benign Het
Letm2 A T 8: 25,592,537 C174* probably null Het
Met T G 6: 17,558,835 V1154G probably damaging Het
Mindy3 A G 2: 12,419,189 S22P probably benign Het
Mroh2b G A 15: 4,917,131 R471Q probably damaging Het
Nfe2l3 T C 6: 51,458,272 L604P probably damaging Het
Olfr1044 A T 2: 86,171,220 I199N possibly damaging Het
Olfr1145 A G 2: 87,810,339 Q173R probably damaging Het
Olfr186 T A 16: 59,027,019 Q296L possibly damaging Het
Olfr294 A G 7: 86,616,561 F28S possibly damaging Het
Olfr824 A C 10: 130,126,586 I157S probably damaging Het
Olfr918 C T 9: 38,672,623 V274I probably benign Het
Pcdha9 T A 18: 36,999,796 Y639* probably null Het
Pom121l2 A T 13: 21,983,529 I657L probably damaging Het
Prr14l T A 5: 32,829,623 T843S possibly damaging Het
Rln1 A T 19: 29,332,099 N93K probably damaging Het
Rpl3l A T 17: 24,732,427 M101L probably benign Het
Rtkn A G 6: 83,152,177 Y551C probably benign Het
Rundc1 G C 11: 101,433,479 R337P possibly damaging Het
Scarf1 T A 11: 75,514,416 probably null Het
Serpinb1b T A 13: 33,091,639 probably null Het
Sgsm1 A T 5: 113,274,335 C484* probably null Het
Slc22a19 T A 19: 7,673,303 K547* probably null Het
Slc22a19 T C 19: 7,693,818 T177A probably benign Het
Slc6a5 A C 7: 49,941,866 K526N probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stard9 T C 2: 120,688,146 I517T probably benign Het
Taf15 A T 11: 83,505,023 D518V unknown Het
Tdgf1 C T 9: 110,945,949 probably benign Het
Tenm4 A G 7: 96,895,985 M2440V possibly damaging Het
Tm6sf1 A G 7: 81,868,710 M122V possibly damaging Het
Tmprss9 T A 10: 80,892,219 S548T possibly damaging Het
Trim62 A T 4: 128,883,678 probably benign Het
Ugt2b34 C T 5: 86,891,282 V507M possibly damaging Het
Usp16 T A 16: 87,476,805 M423K probably benign Het
Vmn1r199 T A 13: 22,382,736 S67T probably benign Het
Vmn1r62 A T 7: 5,675,601 M94L probably benign Het
Wnk4 G T 11: 101,264,354 E364* probably null Het
Xpo1 T A 11: 23,282,584 I368N probably damaging Het
Zfp366 A G 13: 99,246,296 T656A probably benign Het
Zfp934 T C 13: 62,518,524 M113V probably benign Het
Zkscan2 A G 7: 123,498,771 V134A probably damaging Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96608065 missense possibly damaging 0.64
IGL00841:Dscam APN 16 96819877 missense probably damaging 1.00
IGL01289:Dscam APN 16 96643882 nonsense probably null
IGL01358:Dscam APN 16 96610343 missense possibly damaging 0.68
IGL01431:Dscam APN 16 96652078 critical splice donor site probably null
IGL01444:Dscam APN 16 96673709 missense possibly damaging 0.95
IGL01767:Dscam APN 16 96654936 missense probably damaging 1.00
IGL01866:Dscam APN 16 96685350 missense probably benign 0.06
IGL02020:Dscam APN 16 96716069 missense probably damaging 1.00
IGL02023:Dscam APN 16 96801197 missense probably benign 0.06
IGL02057:Dscam APN 16 96716073 nonsense probably null
IGL02389:Dscam APN 16 96640897 missense probably benign 0.27
IGL02409:Dscam APN 16 96819888 missense possibly damaging 0.46
IGL02694:Dscam APN 16 96593276 missense probably benign 0.00
IGL02899:Dscam APN 16 96709247 missense probably damaging 0.98
IGL02956:Dscam APN 16 96801272 missense probably damaging 0.98
IGL03035:Dscam APN 16 96819970 missense possibly damaging 0.94
IGL03191:Dscam APN 16 96820769 missense probably benign 0.36
growler UTSW 16 96820997 missense probably damaging 0.99
Twostep UTSW 16 96825782 splice site probably null
F6893:Dscam UTSW 16 97056460 missense possibly damaging 0.78
K3955:Dscam UTSW 16 96673687 missense probably benign 0.00
R0024:Dscam UTSW 16 96593385 nonsense probably null
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0117:Dscam UTSW 16 96673678 missense probably benign 0.33
R0211:Dscam UTSW 16 96716079 missense possibly damaging 0.50
R0280:Dscam UTSW 16 97039006 missense possibly damaging 0.62
R0355:Dscam UTSW 16 96654905 missense probably benign 0.00
R0380:Dscam UTSW 16 97056610 missense probably damaging 1.00
R0445:Dscam UTSW 16 96772503 missense probably damaging 1.00
R0492:Dscam UTSW 16 96825782 splice site probably null
R0534:Dscam UTSW 16 96652172 missense possibly damaging 0.67
R0593:Dscam UTSW 16 96772408 missense probably benign 0.19
R0707:Dscam UTSW 16 96825782 splice site probably null
R0738:Dscam UTSW 16 96819781 missense possibly damaging 0.48
R1017:Dscam UTSW 16 96833433 missense probably damaging 1.00
R1377:Dscam UTSW 16 96772494 missense probably damaging 1.00
R1440:Dscam UTSW 16 96819951 missense probably damaging 1.00
R1442:Dscam UTSW 16 96608074 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1478:Dscam UTSW 16 96790910 missense probably benign 0.15
R1530:Dscam UTSW 16 96819874 missense probably damaging 1.00
R1731:Dscam UTSW 16 96819876 missense probably damaging 1.00
R1765:Dscam UTSW 16 96685379 missense probably benign 0.00
R1824:Dscam UTSW 16 96825581 missense probably benign 0.00
R1933:Dscam UTSW 16 96593214 missense probably benign 0.00
R2005:Dscam UTSW 16 97038920 missense probably benign 0.02
R2006:Dscam UTSW 16 96819912 missense probably damaging 1.00
R2101:Dscam UTSW 16 96610349 missense probably benign 0.00
R2177:Dscam UTSW 16 96610324 missense probably damaging 0.98
R2342:Dscam UTSW 16 96619502 missense probably damaging 1.00
R2851:Dscam UTSW 16 96622715 missense possibly damaging 0.94
R2929:Dscam UTSW 16 96685412 missense possibly damaging 0.76
R3055:Dscam UTSW 16 96801355 missense probably damaging 1.00
R3157:Dscam UTSW 16 96678510 missense probably benign 0.16
R3159:Dscam UTSW 16 96678510 missense probably benign 0.16
R3944:Dscam UTSW 16 96820997 missense probably damaging 0.99
R4080:Dscam UTSW 16 96683772 missense probably benign 0.01
R4285:Dscam UTSW 16 96709109 critical splice donor site probably null
R4384:Dscam UTSW 16 96709216 missense probably damaging 0.99
R4460:Dscam UTSW 16 96610319 missense probably damaging 1.00
R4575:Dscam UTSW 16 96825623 missense possibly damaging 0.82
R4594:Dscam UTSW 16 96717996 missense possibly damaging 0.78
R4643:Dscam UTSW 16 96685301 missense probably damaging 0.96
R4698:Dscam UTSW 16 96610324 missense probably damaging 1.00
R4716:Dscam UTSW 16 96619571 missense possibly damaging 0.80
R4743:Dscam UTSW 16 96830056 missense probably benign 0.00
R4766:Dscam UTSW 16 96643988 missense probably benign 0.02
R4899:Dscam UTSW 16 96683818 missense probably benign 0.01
R4987:Dscam UTSW 16 96697521 missense probably benign 0.00
R4990:Dscam UTSW 16 96825515 missense probably benign 0.12
R5123:Dscam UTSW 16 96772437 missense probably damaging 1.00
R5130:Dscam UTSW 16 96819779 missense probably benign 0.00
R5328:Dscam UTSW 16 96673678 missense probably benign 0.33
R5666:Dscam UTSW 16 96718164 missense probably benign 0.23
R5670:Dscam UTSW 16 96718164 missense probably benign 0.23
R5678:Dscam UTSW 16 96790900 missense probably benign 0.16
R5827:Dscam UTSW 16 96649991 critical splice donor site probably null
R5907:Dscam UTSW 16 96820920 missense probably damaging 0.97
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6103:Dscam UTSW 16 96825581 missense probably benign
R6240:Dscam UTSW 16 96619502 missense probably damaging 1.00
R6257:Dscam UTSW 16 96673714 missense possibly damaging 0.94
R6361:Dscam UTSW 16 96622811 missense probably benign 0.08
R6405:Dscam UTSW 16 96678425 missense probably damaging 1.00
R6444:Dscam UTSW 16 96619644 missense probably damaging 1.00
R6560:Dscam UTSW 16 96825735 missense probably benign 0.00
R6598:Dscam UTSW 16 96819784 missense probably damaging 1.00
R6622:Dscam UTSW 16 96645073 missense probably benign 0.06
R6792:Dscam UTSW 16 96593255 missense probably damaging 0.96
R6792:Dscam UTSW 16 96648237 missense probably damaging 1.00
R6827:Dscam UTSW 16 97038991 missense probably damaging 1.00
R6868:Dscam UTSW 16 96829940 missense probably damaging 1.00
R6898:Dscam UTSW 16 96829900 missense probably benign 0.02
R6903:Dscam UTSW 16 96820788 missense probably damaging 1.00
R7051:Dscam UTSW 16 96819786 missense probably benign 0.01
R7146:Dscam UTSW 16 96829917 nonsense probably null
R7180:Dscam UTSW 16 96825564 missense probably damaging 0.97
R7209:Dscam UTSW 16 96650344 splice site probably null
R7247:Dscam UTSW 16 96820808 missense probably damaging 0.99
R7269:Dscam UTSW 16 96678401 missense probably benign 0.00
R7301:Dscam UTSW 16 97056532 missense probably benign 0.01
R7328:Dscam UTSW 16 96645035 nonsense probably null
R7368:Dscam UTSW 16 96643931 missense probably benign 0.00
R7425:Dscam UTSW 16 96629398 missense probably damaging 1.00
R7474:Dscam UTSW 16 96819889 missense possibly damaging 0.88
R7536:Dscam UTSW 16 96641026 splice site probably null
R7766:Dscam UTSW 16 96790901 missense probably benign 0.31
R7817:Dscam UTSW 16 96640864 missense probably benign
R7843:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7911:Dscam UTSW 16 96643922 missense probably benign 0.01
R8108:Dscam UTSW 16 96643879 missense probably benign 0.01
R8128:Dscam UTSW 16 96801174 splice site probably null
R8770:Dscam UTSW 16 96654906 missense possibly damaging 0.50
R8876:Dscam UTSW 16 96619628 missense probably damaging 0.96
R9005:Dscam UTSW 16 96801380 missense probably damaging 1.00
R9009:Dscam UTSW 16 97038916 missense probably benign 0.10
R9168:Dscam UTSW 16 96619568 missense possibly damaging 0.82
R9176:Dscam UTSW 16 96685353 missense probably benign 0.37
R9244:Dscam UTSW 16 96685229 missense possibly damaging 0.62
R9339:Dscam UTSW 16 96716063 missense possibly damaging 0.89
R9374:Dscam UTSW 16 97056657 missense probably benign 0.19
R9385:Dscam UTSW 16 97039003 missense probably benign
R9674:Dscam UTSW 16 96640836 missense probably benign 0.03
X0025:Dscam UTSW 16 96709161 missense probably damaging 1.00
Z1088:Dscam UTSW 16 96772561 missense probably benign 0.01
Z1177:Dscam UTSW 16 96608189 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCAATCCTGCAGAACTCAGTAAG -3'
(R):5'- TTGTTGCAGATCCCACCACC -3'

Sequencing Primer
(F):5'- CTGCAGAACTCAGTAAGGCCTTG -3'
(R):5'- CACCACCAGGAGGAATGC -3'
Posted On 2019-10-24