Incidental Mutation 'R7624:Ctnna1'
ID589357
Institutional Source Beutler Lab
Gene Symbol Ctnna1
Ensembl Gene ENSMUSG00000037815
Gene Namecatenin (cadherin associated protein), alpha 1
Synonymsalpha E catenin, alpha(E)-catenin, 2010010M04Rik, Catna1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7624 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location35118888-35254773 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35244844 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 632 (I632N)
Ref Sequence ENSEMBL: ENSMUSP00000049007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042345]
PDB Structure CRYSTAL STRUCTURE OF THE ALPHA-CATENIN DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF A CHIMERA OF BETA-CATENIN AND ALPHA-CATENIN [X-RAY DIFFRACTION]
alpha-catenin fragment, residues 385-651 [X-RAY DIFFRACTION]
Alpha-E-catenin is an autoinhibited molecule that co-activates vinculin [X-RAY DIFFRACTION]
Alpha-E-catenin is an autoinhibited molecule that co-activates vinculin [X-RAY DIFFRACTION]
Crystal structure of full-length mouse alphaE-catenin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000042345
AA Change: I632N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049007
Gene: ENSMUSG00000037815
AA Change: I632N

DomainStartEndE-ValueType
Pfam:Vinculin 19 339 2.6e-99 PFAM
Pfam:Vinculin 333 867 3.3e-218 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the catenin family of proteins that play an important role in cell adhesion process by connecting cadherins located on the plasma membrane to the actin filaments inside the cell. The encoded mechanosensing protein contains three vinculin homology domains and undergoes conformational changes in response to cytoskeletal tension, resulting in the reconfiguration of cadherin-actin filament connections. Certain mutations in this gene cause butterfly-shaped pigment dystrophy. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. A conditional knockout in surface epithelium results in defects in hair follicle development and epidermal morphogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm C A 9: 53,454,768 R2533L probably damaging Het
Caprin1 T A 2: 103,772,677 M514L possibly damaging Het
Ccdc78 A G 17: 25,787,152 E98G probably damaging Het
Cmya5 A T 13: 93,090,357 M2741K possibly damaging Het
Cnot1 T G 8: 95,751,819 R959S probably damaging Het
Col12a1 G T 9: 79,645,794 probably null Het
Col4a3 A G 1: 82,718,884 T177A probably benign Het
Cpa3 T C 3: 20,225,143 N211D possibly damaging Het
Cryba1 T C 11: 77,722,717 Y36C probably damaging Het
D630045J12Rik T C 6: 38,149,563 N1504S probably damaging Het
Dgkz C A 2: 91,942,674 R346L probably damaging Het
Dnajc21 G A 15: 10,461,232 R211C probably benign Het
Dnajc21 A T 15: 10,461,234 I210N probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Eya3 A G 4: 132,672,951 T94A probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T C 9: 15,959,869 D3742G possibly damaging Het
Ficd T C 5: 113,738,690 F309L probably benign Het
Gfra1 A T 19: 58,238,446 M451K probably benign Het
Gm43517 T A 12: 49,391,178 L318Q Het
Gsc A T 12: 104,473,051 V22E possibly damaging Het
Il4ra T C 7: 125,569,108 Y100H probably damaging Het
Ilf3 T C 9: 21,398,044 S486P probably benign Het
Itga10 T A 3: 96,652,953 H594Q probably benign Het
Kcnf1 T C 12: 17,176,136 D28G probably benign Het
Kiss1 A G 1: 133,329,422 K53R possibly damaging Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Lcorl T C 5: 45,701,965 D269G probably benign Het
Letm2 A T 8: 25,592,537 C174* probably null Het
Met T G 6: 17,558,835 V1154G probably damaging Het
Mindy3 A G 2: 12,419,189 S22P probably benign Het
Mroh2b G A 15: 4,917,131 R471Q probably damaging Het
Nfe2l3 T C 6: 51,458,272 L604P probably damaging Het
Olfr1044 A T 2: 86,171,220 I199N possibly damaging Het
Olfr1145 A G 2: 87,810,339 Q173R probably damaging Het
Olfr186 T A 16: 59,027,019 Q296L possibly damaging Het
Olfr294 A G 7: 86,616,561 F28S possibly damaging Het
Olfr824 A C 10: 130,126,586 I157S probably damaging Het
Olfr918 C T 9: 38,672,623 V274I probably benign Het
Pcdha9 T A 18: 36,999,796 Y639* probably null Het
Pom121l2 A T 13: 21,983,529 I657L probably damaging Het
Prr14l T A 5: 32,829,623 T843S possibly damaging Het
Rln1 A T 19: 29,332,099 N93K probably damaging Het
Rpl3l A T 17: 24,732,427 M101L probably benign Het
Rtkn A G 6: 83,152,177 Y551C probably benign Het
Rundc1 G C 11: 101,433,479 R337P possibly damaging Het
Scarf1 T A 11: 75,514,416 probably null Het
Serpinb1b T A 13: 33,091,639 probably null Het
Sgsm1 A T 5: 113,274,335 C484* probably null Het
Slc22a19 T A 19: 7,673,303 K547* probably null Het
Slc22a19 T C 19: 7,693,818 T177A probably benign Het
Slc6a5 A C 7: 49,941,866 K526N probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stard9 T C 2: 120,688,146 I517T probably benign Het
Taf15 A T 11: 83,505,023 D518V unknown Het
Tdgf1 C T 9: 110,945,949 probably benign Het
Tenm4 A G 7: 96,895,985 M2440V possibly damaging Het
Tm6sf1 A G 7: 81,868,710 M122V possibly damaging Het
Tmprss9 T A 10: 80,892,219 S548T possibly damaging Het
Trim62 A T 4: 128,883,678 probably benign Het
Ugt2b34 C T 5: 86,891,282 V507M possibly damaging Het
Usp16 T A 16: 87,476,805 M423K probably benign Het
Vmn1r199 T A 13: 22,382,736 S67T probably benign Het
Vmn1r62 A T 7: 5,675,601 M94L probably benign Het
Wnk4 G T 11: 101,264,354 E364* probably null Het
Xpo1 T A 11: 23,282,584 I368N probably damaging Het
Zfp366 A G 13: 99,246,296 T656A probably benign Het
Zfp934 T C 13: 62,518,524 M113V probably benign Het
Zkscan2 A G 7: 123,498,771 V134A probably damaging Het
Other mutations in Ctnna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Ctnna1 APN 18 35223448 missense probably damaging 0.97
IGL03068:Ctnna1 APN 18 35249732 missense possibly damaging 0.66
IGL03286:Ctnna1 APN 18 35175153 missense probably benign 0.37
PIT4458001:Ctnna1 UTSW 18 35175126 missense possibly damaging 0.65
R0282:Ctnna1 UTSW 18 35244122 missense possibly damaging 0.79
R1971:Ctnna1 UTSW 18 35154527 missense probably benign
R2117:Ctnna1 UTSW 18 35152625 missense possibly damaging 0.76
R2424:Ctnna1 UTSW 18 35253707 missense probably benign 0.00
R4602:Ctnna1 UTSW 18 35179827 missense possibly damaging 0.92
R4812:Ctnna1 UTSW 18 35239477 missense probably damaging 1.00
R5120:Ctnna1 UTSW 18 35182554 critical splice donor site probably null
R5469:Ctnna1 UTSW 18 35239520 missense probably benign 0.00
R5607:Ctnna1 UTSW 18 35249742 missense probably benign 0.25
R5629:Ctnna1 UTSW 18 35249749 missense probably benign
R5824:Ctnna1 UTSW 18 35179886 missense probably benign
R5971:Ctnna1 UTSW 18 35154514 missense probably benign
R6191:Ctnna1 UTSW 18 35174355 missense probably damaging 1.00
R7065:Ctnna1 UTSW 18 35152616 missense probably benign
R7519:Ctnna1 UTSW 18 35174371 missense probably benign 0.02
R7636:Ctnna1 UTSW 18 35223473 missense possibly damaging 0.92
R8086:Ctnna1 UTSW 18 35152660 missense possibly damaging 0.55
R8354:Ctnna1 UTSW 18 35252723 missense possibly damaging 0.94
R8765:Ctnna1 UTSW 18 35251240 missense probably damaging 0.97
R8889:Ctnna1 UTSW 18 35239533 missense possibly damaging 0.46
R8892:Ctnna1 UTSW 18 35239533 missense possibly damaging 0.46
U15987:Ctnna1 UTSW 18 35154514 missense probably benign
X0021:Ctnna1 UTSW 18 35182545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAAGGATTCAGGGAAGGTTG -3'
(R):5'- ACTGCCACTGTATCTACTGAGTTC -3'

Sequencing Primer
(F):5'- ATCTGTGCAGTGCGACCTGTC -3'
(R):5'- GATGGCTCAGCAGTCCAGAAC -3'
Posted On2019-10-24