Incidental Mutation 'R7624:Pcdha9'
ID589358
Institutional Source Beutler Lab
Gene Symbol Pcdha9
Ensembl Gene ENSMUSG00000103770
Gene Nameprotocadherin alpha 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R7624 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location36997880-37187657 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 36999796 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 639 (Y639*)
Ref Sequence ENSEMBL: ENSMUSP00000111323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115659
AA Change: Y639*
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770
AA Change: Y639*

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm C A 9: 53,454,768 R2533L probably damaging Het
Caprin1 T A 2: 103,772,677 M514L possibly damaging Het
Ccdc78 A G 17: 25,787,152 E98G probably damaging Het
Cmya5 A T 13: 93,090,357 M2741K possibly damaging Het
Cnot1 T G 8: 95,751,819 R959S probably damaging Het
Col12a1 G T 9: 79,645,794 probably null Het
Col4a3 A G 1: 82,718,884 T177A probably benign Het
Cpa3 T C 3: 20,225,143 N211D possibly damaging Het
Cryba1 T C 11: 77,722,717 Y36C probably damaging Het
Ctnna1 T A 18: 35,244,844 I632N probably benign Het
D630045J12Rik T C 6: 38,149,563 N1504S probably damaging Het
Dgkz C A 2: 91,942,674 R346L probably damaging Het
Dnajc21 G A 15: 10,461,232 R211C probably benign Het
Dnajc21 A T 15: 10,461,234 I210N probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Eya3 A G 4: 132,672,951 T94A probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T C 9: 15,959,869 D3742G possibly damaging Het
Ficd T C 5: 113,738,690 F309L probably benign Het
Gfra1 A T 19: 58,238,446 M451K probably benign Het
Gm43517 T A 12: 49,391,178 L318Q Het
Gsc A T 12: 104,473,051 V22E possibly damaging Het
Il4ra T C 7: 125,569,108 Y100H probably damaging Het
Ilf3 T C 9: 21,398,044 S486P probably benign Het
Itga10 T A 3: 96,652,953 H594Q probably benign Het
Kcnf1 T C 12: 17,176,136 D28G probably benign Het
Kiss1 A G 1: 133,329,422 K53R possibly damaging Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Lcorl T C 5: 45,701,965 D269G probably benign Het
Letm2 A T 8: 25,592,537 C174* probably null Het
Met T G 6: 17,558,835 V1154G probably damaging Het
Mindy3 A G 2: 12,419,189 S22P probably benign Het
Mroh2b G A 15: 4,917,131 R471Q probably damaging Het
Nfe2l3 T C 6: 51,458,272 L604P probably damaging Het
Olfr1044 A T 2: 86,171,220 I199N possibly damaging Het
Olfr1145 A G 2: 87,810,339 Q173R probably damaging Het
Olfr186 T A 16: 59,027,019 Q296L possibly damaging Het
Olfr294 A G 7: 86,616,561 F28S possibly damaging Het
Olfr824 A C 10: 130,126,586 I157S probably damaging Het
Olfr918 C T 9: 38,672,623 V274I probably benign Het
Pom121l2 A T 13: 21,983,529 I657L probably damaging Het
Prr14l T A 5: 32,829,623 T843S possibly damaging Het
Rln1 A T 19: 29,332,099 N93K probably damaging Het
Rpl3l A T 17: 24,732,427 M101L probably benign Het
Rtkn A G 6: 83,152,177 Y551C probably benign Het
Rundc1 G C 11: 101,433,479 R337P possibly damaging Het
Scarf1 T A 11: 75,514,416 probably null Het
Serpinb1b T A 13: 33,091,639 probably null Het
Sgsm1 A T 5: 113,274,335 C484* probably null Het
Slc22a19 T A 19: 7,673,303 K547* probably null Het
Slc22a19 T C 19: 7,693,818 T177A probably benign Het
Slc6a5 A C 7: 49,941,866 K526N probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stard9 T C 2: 120,688,146 I517T probably benign Het
Taf15 A T 11: 83,505,023 D518V unknown Het
Tdgf1 C T 9: 110,945,949 probably benign Het
Tenm4 A G 7: 96,895,985 M2440V possibly damaging Het
Tm6sf1 A G 7: 81,868,710 M122V possibly damaging Het
Tmprss9 T A 10: 80,892,219 S548T possibly damaging Het
Trim62 A T 4: 128,883,678 probably benign Het
Ugt2b34 C T 5: 86,891,282 V507M possibly damaging Het
Usp16 T A 16: 87,476,805 M423K probably benign Het
Vmn1r199 T A 13: 22,382,736 S67T probably benign Het
Vmn1r62 A T 7: 5,675,601 M94L probably benign Het
Wnk4 G T 11: 101,264,354 E364* probably null Het
Xpo1 T A 11: 23,282,584 I368N probably damaging Het
Zfp366 A G 13: 99,246,296 T656A probably benign Het
Zfp934 T C 13: 62,518,524 M113V probably benign Het
Zkscan2 A G 7: 123,498,771 V134A probably damaging Het
Other mutations in Pcdha9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0761:Pcdha9 UTSW 18 36999963 nonsense probably null
R2985:Pcdha9 UTSW 18 36998202 missense possibly damaging 0.88
R3926:Pcdha9 UTSW 18 36999412 missense probably damaging 1.00
R4049:Pcdha9 UTSW 18 36997942 missense probably benign 0.16
R4409:Pcdha9 UTSW 18 36999145 missense probably benign 0.12
R4816:Pcdha9 UTSW 18 36999458 missense probably damaging 1.00
R4905:Pcdha9 UTSW 18 36998892 missense probably damaging 0.96
R4991:Pcdha9 UTSW 18 36998345 missense probably damaging 0.99
R5484:Pcdha9 UTSW 18 36998103 missense probably damaging 1.00
R5487:Pcdha9 UTSW 18 36999650 missense probably damaging 1.00
R5617:Pcdha9 UTSW 18 36998816 missense probably benign 0.03
R5637:Pcdha9 UTSW 18 36998373 missense probably benign 0.00
R5694:Pcdha9 UTSW 18 36998372 missense probably benign 0.00
R5975:Pcdha9 UTSW 18 36999111 missense probably benign 0.00
R6089:Pcdha9 UTSW 18 36998498 missense probably benign 0.00
R6176:Pcdha9 UTSW 18 36998931 missense probably benign 0.24
R6220:Pcdha9 UTSW 18 36998478 missense probably damaging 1.00
R6238:Pcdha9 UTSW 18 36998975 missense probably benign 0.43
R6391:Pcdha9 UTSW 18 36997919 missense probably benign 0.12
R6622:Pcdha9 UTSW 18 36998654 missense possibly damaging 0.84
R6720:Pcdha9 UTSW 18 36998069 missense probably damaging 0.99
R7239:Pcdha9 UTSW 18 36998498 missense probably benign 0.06
R7721:Pcdha9 UTSW 18 36999636 missense probably benign
R8211:Pcdha9 UTSW 18 36998859 missense possibly damaging 0.56
R8483:Pcdha9 UTSW 18 36998583 missense probably benign 0.01
R8778:Pcdha9 UTSW 18 36999191 missense possibly damaging 0.65
Z1177:Pcdha9 UTSW 18 36998214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATGTGACTCTGCAGGTG -3'
(R):5'- TGGGAAGAAGCTTTTGGCAC -3'

Sequencing Primer
(F):5'- GTTTGTGCAGGATGAGAATGACAATC -3'
(R):5'- AAGAAGCTTTTGGCACCTGGC -3'
Posted On2019-10-24