Incidental Mutation 'R7625:Pikfyve'
ID589363
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Namephosphoinositide kinase, FYVE type zinc finger containing
SynonymsPip5k3
Accession Numbers

Genbank: NM_011086

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7625 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location65186683-65278695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65267877 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1808 (V1808A)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
Predicted Effect probably benign
Transcript: ENSMUST00000081154
AA Change: V1763A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: V1763A

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097707
AA Change: V1808A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: V1808A

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,046,955 V506E probably damaging Het
Acaa2 G T 18: 74,804,142 V366F possibly damaging Het
Ago1 G A 4: 126,443,229 R532C probably benign Het
Ank2 T G 3: 127,052,800 D182A probably damaging Het
Anxa4 T C 6: 86,737,819 D302G probably damaging Het
Apoa4 A T 9: 46,243,112 E337V probably damaging Het
Atp8b3 A C 10: 80,520,146 V1244G probably benign Het
BC080695 A T 4: 143,572,251 I255L probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camk2a G A 18: 60,952,340 V132M probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Chd8 G A 14: 52,237,077 P166S probably benign Het
Chl1 T A 6: 103,729,125 S1140R probably damaging Het
Clstn3 G T 6: 124,437,418 S783* probably null Het
Col6a1 A G 10: 76,713,926 S562P unknown Het
Cpb2 G A 14: 75,272,549 V250M possibly damaging Het
Cyp2c38 T A 19: 39,462,924 Q44L possibly damaging Het
Dgat1 T C 15: 76,503,195 M325V possibly damaging Het
Dnah11 T A 12: 118,196,642 M118L probably benign Het
Dpy19l3 T A 7: 35,752,681 I13L probably benign Het
Enkd1 A G 8: 105,704,633 probably null Het
Fam241b A G 10: 62,134,700 probably benign Het
Fhit T A 14: 9,870,177 probably null Het
Gm21994 T C 2: 150,254,600 D303G probably benign Het
Gp6 T C 7: 4,370,174 E250G probably benign Het
Hmgb1 T C 5: 149,050,340 E84G probably benign Het
Hscb T A 5: 110,829,146 I227F probably damaging Het
Hspg2 T A 4: 137,564,938 L4047Q probably damaging Het
Hsph1 A G 5: 149,618,436 L775P probably benign Het
Hydin A T 8: 110,541,844 S2947C probably benign Het
Intu T C 3: 40,697,599 S829P probably benign Het
Kcnn3 C A 3: 89,609,670 T462K probably damaging Het
Kndc1 G A 7: 139,938,017 C1622Y possibly damaging Het
Lifr T C 15: 7,169,242 Y318H probably damaging Het
Mier2 A G 10: 79,542,709 S332P probably damaging Het
Mindy4 T C 6: 55,276,613 I489T possibly damaging Het
Mmp8 A T 9: 7,566,217 Q358L probably benign Het
Ms4a4a T A 19: 11,390,364 probably null Het
Nav1 G C 1: 135,467,745 S962C probably damaging Het
Nfe2l1 G A 11: 96,819,445 R653C probably damaging Het
Nod2 A T 8: 88,665,278 I738F probably damaging Het
Nrf1 G A 6: 30,116,231 V301I probably benign Het
Olfr424 G A 1: 174,137,167 C141Y probably benign Het
Olfr622 A G 7: 103,639,958 Y61H probably damaging Het
Oog1 T C 12: 87,608,312 F410S probably benign Het
Pcdhga8 G A 18: 37,726,901 V337I probably benign Het
Pdzd3 A T 9: 44,250,297 I95N probably damaging Het
Pelp1 G T 11: 70,395,434 N572K probably benign Het
Pirt A C 11: 66,925,943 S27R probably damaging Het
Rgs17 A T 10: 5,841,488 D96E probably benign Het
Senp1 A G 15: 98,066,798 F206L probably benign Het
Sh3rf1 T A 8: 61,372,722 S584T probably benign Het
Tex44 A T 1: 86,426,737 K123* probably null Het
Tpst2 C A 5: 112,308,021 T142K probably damaging Het
Ttc28 G A 5: 111,285,219 G2040R possibly damaging Het
Uggt2 T A 14: 119,026,493 I1042F probably damaging Het
Vmn2r91 T C 17: 18,105,431 S104P probably damaging Het
Zeb2 G A 2: 45,002,572 A223V probably damaging Het
Zfp566 A G 7: 30,078,505 S84P probably benign Het
Zfp994 T A 17: 22,201,755 H71L possibly damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65260121 critical splice donor site probably null
IGL01135:Pikfyve APN 1 65251635 missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65258869 nonsense probably null
IGL01759:Pikfyve APN 1 65253353 missense probably benign 0.06
IGL01888:Pikfyve APN 1 65223640 missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65264365 missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65238544 critical splice donor site probably null
IGL02119:Pikfyve APN 1 65272571 missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65246397 missense probably benign 0.13
IGL02207:Pikfyve APN 1 65251678 critical splice donor site probably null
IGL02380:Pikfyve APN 1 65256021 missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65252569 missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65244504 missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65251612 missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65264376 missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65230855 critical splice donor site probably null
IGL02746:Pikfyve APN 1 65234272 missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65250194 nonsense probably null
IGL02890:Pikfyve APN 1 65230797 missense probably benign 0.00
IGL03102:Pikfyve APN 1 65252467 nonsense probably null
IGL03294:Pikfyve APN 1 65247067 missense probably damaging 1.00
falcon UTSW 1 65196741 missense probably damaging 1.00
oompa UTSW 1 65196706 missense probably damaging 1.00
wonka UTSW 1 65196706 missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65202916 missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65215929 splice site probably benign
R0196:Pikfyve UTSW 1 65256072 missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65262905 missense probably benign 0.41
R0319:Pikfyve UTSW 1 65246331 missense probably benign 0.01
R0332:Pikfyve UTSW 1 65264399 missense probably benign 0.02
R0389:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65219899 missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65253523 missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65253397 missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65265824 missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65246959 missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65271311 missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65224201 missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65262977 critical splice donor site probably null
R1501:Pikfyve UTSW 1 65265284 missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65252548 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65192271 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65246370 missense probably benign
R1795:Pikfyve UTSW 1 65252557 missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65258798 missense probably benign 0.03
R1905:Pikfyve UTSW 1 65192295 critical splice donor site probably null
R1995:Pikfyve UTSW 1 65246708 missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65222357 missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65253353 missense probably benign 0.06
R2229:Pikfyve UTSW 1 65267855 missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65246676 missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65253517 missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65245758 missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65244420 missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65230845 missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65196681 missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65190520 unclassified probably benign
R4542:Pikfyve UTSW 1 65244430 missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65192192 missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65234262 missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65267846 missense probably benign
R4716:Pikfyve UTSW 1 65246476 missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65272515 missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65267846 missense probably benign
R4785:Pikfyve UTSW 1 65267846 missense probably benign
R4805:Pikfyve UTSW 1 65268800 missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65196741 missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65246590 missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65224117 intron probably benign
R5265:Pikfyve UTSW 1 65267829 missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65196699 nonsense probably null
R5384:Pikfyve UTSW 1 65244409 missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65265268 missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65235033 missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65252495 missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65273730 missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65256088 missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65216028 missense probably benign 0.09
R5891:Pikfyve UTSW 1 65202737 missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65253438 nonsense probably null
R6026:Pikfyve UTSW 1 65272697 missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65272571 missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65216043 missense probably benign 0.36
R6287:Pikfyve UTSW 1 65253532 critical splice donor site probably null
R6290:Pikfyve UTSW 1 65202925 critical splice donor site probably null
R6296:Pikfyve UTSW 1 65262953 missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65265781 missense probably benign 0.35
R6835:Pikfyve UTSW 1 65258843 missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65252530 missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65246663 missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65234361 missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65246854 missense probably benign 0.01
R7057:Pikfyve UTSW 1 65247205 missense probably benign 0.00
R7525:Pikfyve UTSW 1 65244426 nonsense probably null
R7558:Pikfyve UTSW 1 65272623 missense probably benign 0.01
R7807:Pikfyve UTSW 1 65269942 missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65255134 missense not run
Predicted Primers PCR Primer
(F):5'- CACAATTTGTCTGTCTAATGTGTGC -3'
(R):5'- AAACATCTTAGTGCTCGCCAAG -3'

Sequencing Primer
(F):5'- GACTTGCTAACTTCTGTTGC -3'
(R):5'- GCCAAGCTCTACATCTCTCAATTAC -3'
Posted On2019-10-24