Incidental Mutation 'R7625:Ago1'
ID589372
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Nameargonaute RISC catalytic subunit 1
SynonymsEif2c1, argonaute 1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock #R7625 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location126435012-126468583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126443229 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 532 (R532C)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
Predicted Effect probably benign
Transcript: ENSMUST00000097888
AA Change: R532C

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: R532C

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect probably benign
Transcript: ENSMUST00000176315
AA Change: R228C

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: R228C

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,046,955 V506E probably damaging Het
Acaa2 G T 18: 74,804,142 V366F possibly damaging Het
Ank2 T G 3: 127,052,800 D182A probably damaging Het
Anxa4 T C 6: 86,737,819 D302G probably damaging Het
Apoa4 A T 9: 46,243,112 E337V probably damaging Het
Atf1 A G 15: 100,254,277 probably null Het
Atp8b3 A C 10: 80,520,146 V1244G probably benign Het
BC080695 A T 4: 143,572,251 I255L probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camk2a G A 18: 60,952,340 V132M probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Chd8 G A 14: 52,237,077 P166S probably benign Het
Chl1 T A 6: 103,729,125 S1140R probably damaging Het
Clstn3 G T 6: 124,437,418 S783* probably null Het
Col6a1 A G 10: 76,713,926 S562P unknown Het
Cpb2 G A 14: 75,272,549 V250M possibly damaging Het
Cyp2c38 T A 19: 39,462,924 Q44L possibly damaging Het
Dgat1 T C 15: 76,503,195 M325V possibly damaging Het
Dnah11 T A 12: 118,196,642 M118L probably benign Het
Dpy19l3 T A 7: 35,752,681 I13L probably benign Het
Enkd1 A G 8: 105,704,633 probably null Het
Fam241b A G 10: 62,134,700 probably benign Het
Fhit T A 14: 9,870,177 probably null Het
Gm21994 T C 2: 150,254,600 D303G probably benign Het
Gp6 T C 7: 4,370,174 E250G probably benign Het
Hmgb1 T C 5: 149,050,340 E84G probably benign Het
Hscb T A 5: 110,829,146 I227F probably damaging Het
Hspg2 T A 4: 137,564,938 L4047Q probably damaging Het
Hsph1 A G 5: 149,618,436 L775P probably benign Het
Hydin A T 8: 110,541,844 S2947C probably benign Het
Intu T C 3: 40,697,599 S829P probably benign Het
Kcnn3 C A 3: 89,609,670 T462K probably damaging Het
Kndc1 G A 7: 139,938,017 C1622Y possibly damaging Het
Lifr T C 15: 7,169,242 Y318H probably damaging Het
Mier2 A G 10: 79,542,709 S332P probably damaging Het
Mindy4 T C 6: 55,276,613 I489T possibly damaging Het
Mmp8 A T 9: 7,566,217 Q358L probably benign Het
Ms4a4a T A 19: 11,390,364 probably null Het
Nav1 G C 1: 135,467,745 S962C probably damaging Het
Nfe2l1 G A 11: 96,819,445 R653C probably damaging Het
Nod2 A T 8: 88,665,278 I738F probably damaging Het
Nrf1 G A 6: 30,116,231 V301I probably benign Het
Olfr424 G A 1: 174,137,167 C141Y probably benign Het
Olfr622 A G 7: 103,639,958 Y61H probably damaging Het
Oog1 T C 12: 87,608,312 F410S probably benign Het
Pcdhga8 G A 18: 37,726,901 V337I probably benign Het
Pdzd3 A T 9: 44,250,297 I95N probably damaging Het
Pelp1 G T 11: 70,395,434 N572K probably benign Het
Pikfyve T C 1: 65,267,877 V1808A possibly damaging Het
Pirt A C 11: 66,925,943 S27R probably damaging Het
Rgs17 A T 10: 5,841,488 D96E probably benign Het
Senp1 A G 15: 98,066,798 F206L probably benign Het
Sh3rf1 T A 8: 61,372,722 S584T probably benign Het
Tex44 A T 1: 86,426,737 K123* probably null Het
Tpst2 C A 5: 112,308,021 T142K probably damaging Het
Ttc28 G A 5: 111,285,219 G2040R possibly damaging Het
Uggt2 T A 14: 119,026,493 I1042F probably damaging Het
Vmn2r91 T C 17: 18,105,431 S104P probably damaging Het
Wdfy3 T C 5: 101,855,386 probably null Het
Zeb2 G A 2: 45,002,572 A223V probably damaging Het
Zfp566 A G 7: 30,078,505 S84P probably benign Het
Zfp994 T A 17: 22,201,755 H71L possibly damaging Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126459817 missense probably damaging 0.98
IGL02578:Ago1 APN 4 126439531 missense probably benign 0.12
IGL02709:Ago1 APN 4 126453640 nonsense probably null
IGL02810:Ago1 APN 4 126443093 missense probably benign 0.00
IGL03037:Ago1 APN 4 126461794 missense probably benign 0.00
IGL03091:Ago1 APN 4 126459189 missense probably damaging 0.98
IGL03100:Ago1 APN 4 126443171 missense probably benign 0.08
IGL03121:Ago1 APN 4 126460003 missense probably benign 0.00
R0195:Ago1 UTSW 4 126463691 missense probably benign 0.01
R0244:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126443166 missense probably benign 0.06
R0514:Ago1 UTSW 4 126439595 missense probably benign
R0557:Ago1 UTSW 4 126460024 missense probably benign 0.00
R1104:Ago1 UTSW 4 126453633 missense probably damaging 0.99
R1553:Ago1 UTSW 4 126440401 missense probably damaging 0.99
R1624:Ago1 UTSW 4 126463741 missense probably damaging 0.97
R1851:Ago1 UTSW 4 126439995 missense probably benign 0.00
R1867:Ago1 UTSW 4 126441236 missense probably damaging 0.98
R2001:Ago1 UTSW 4 126454394 missense probably null 0.36
R2051:Ago1 UTSW 4 126460453 missense probably benign 0.01
R2057:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R2105:Ago1 UTSW 4 126461788 missense probably benign 0.30
R2117:Ago1 UTSW 4 126463857 unclassified probably null
R2256:Ago1 UTSW 4 126441911 missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126453650 missense probably benign 0.01
R2517:Ago1 UTSW 4 126439939 nonsense probably null
R2850:Ago1 UTSW 4 126443075 splice site probably benign
R2993:Ago1 UTSW 4 126440046 splice site probably benign
R3746:Ago1 UTSW 4 126461044 missense probably benign
R3747:Ago1 UTSW 4 126461044 missense probably benign
R3750:Ago1 UTSW 4 126461044 missense probably benign
R4600:Ago1 UTSW 4 126460392 missense probably benign 0.37
R4934:Ago1 UTSW 4 126448859 missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126453654 missense probably damaging 0.99
R5086:Ago1 UTSW 4 126453604 missense probably benign 0.01
R5132:Ago1 UTSW 4 126461723 missense probably benign 0.01
R5239:Ago1 UTSW 4 126441215 missense probably damaging 1.00
R5609:Ago1 UTSW 4 126461037 missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126448794 missense probably benign 0.01
R5980:Ago1 UTSW 4 126460569 unclassified probably benign
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6398:Ago1 UTSW 4 126448808 missense probably benign 0.26
R6505:Ago1 UTSW 4 126463835 missense probably benign 0.00
R6545:Ago1 UTSW 4 126454352 missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126460422 missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126439505 makesense probably null
R7496:Ago1 UTSW 4 126461752 missense probably benign 0.20
R7575:Ago1 UTSW 4 126453908 missense probably benign 0.12
R8041:Ago1 UTSW 4 126441936 missense probably damaging 1.00
R8073:Ago1 UTSW 4 126443226 missense probably benign 0.04
X0025:Ago1 UTSW 4 126443115 missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126453656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAAGTAAGCGTTCATACC -3'
(R):5'- TTACCCTTCTGCTTGGAGTG -3'

Sequencing Primer
(F):5'- CAAGTAAGCGTTCATACCGCTGG -3'
(R):5'- TCTGCTTGGAGTGCATCTC -3'
Posted On2019-10-24