Incidental Mutation 'R7625:Kndc1'
ID 589389
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, 2410012C07Rik, very-kind, VKIND
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7625 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 139894696-139941537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 139938017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 1622 (C1622Y)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect possibly damaging
Transcript: ENSMUST00000053445
AA Change: C1622Y

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: C1622Y

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,046,955 V506E probably damaging Het
Acaa2 G T 18: 74,804,142 V366F possibly damaging Het
Ago1 G A 4: 126,443,229 R532C probably benign Het
Ank2 T G 3: 127,052,800 D182A probably damaging Het
Anxa4 T C 6: 86,737,819 D302G probably damaging Het
Apoa4 A T 9: 46,243,112 E337V probably damaging Het
Atf1 A G 15: 100,254,277 probably null Het
Atp8b3 A C 10: 80,520,146 V1244G probably benign Het
BC080695 A T 4: 143,572,251 I255L probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camk2a G A 18: 60,952,340 V132M probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Chd8 G A 14: 52,237,077 P166S probably benign Het
Chl1 T A 6: 103,729,125 S1140R probably damaging Het
Clstn3 G T 6: 124,437,418 S783* probably null Het
Col6a1 A G 10: 76,713,926 S562P unknown Het
Cpb2 G A 14: 75,272,549 V250M possibly damaging Het
Cyp2c38 T A 19: 39,462,924 Q44L possibly damaging Het
Dgat1 T C 15: 76,503,195 M325V possibly damaging Het
Dnah11 T A 12: 118,196,642 M118L probably benign Het
Dpy19l3 T A 7: 35,752,681 I13L probably benign Het
Enkd1 A G 8: 105,704,633 probably null Het
Fam241b A G 10: 62,134,700 probably benign Het
Fhit T A 14: 9,870,177 probably null Het
Gm21994 T C 2: 150,254,600 D303G probably benign Het
Gp6 T C 7: 4,370,174 E250G probably benign Het
Hmgb1 T C 5: 149,050,340 E84G probably benign Het
Hscb T A 5: 110,829,146 I227F probably damaging Het
Hspg2 T A 4: 137,564,938 L4047Q probably damaging Het
Hsph1 A G 5: 149,618,436 L775P probably benign Het
Hydin A T 8: 110,541,844 S2947C probably benign Het
Intu T C 3: 40,697,599 S829P probably benign Het
Kcnn3 C A 3: 89,609,670 T462K probably damaging Het
Lifr T C 15: 7,169,242 Y318H probably damaging Het
Mier2 A G 10: 79,542,709 S332P probably damaging Het
Mindy4 T C 6: 55,276,613 I489T possibly damaging Het
Mmp8 A T 9: 7,566,217 Q358L probably benign Het
Ms4a4a T A 19: 11,390,364 probably null Het
Nav1 G C 1: 135,467,745 S962C probably damaging Het
Nfe2l1 G A 11: 96,819,445 R653C probably damaging Het
Nod2 A T 8: 88,665,278 I738F probably damaging Het
Nrf1 G A 6: 30,116,231 V301I probably benign Het
Olfr424 G A 1: 174,137,167 C141Y probably benign Het
Olfr622 A G 7: 103,639,958 Y61H probably damaging Het
Oog1 T C 12: 87,608,312 F410S probably benign Het
Pcdhga8 G A 18: 37,726,901 V337I probably benign Het
Pdzd3 A T 9: 44,250,297 I95N probably damaging Het
Pelp1 G T 11: 70,395,434 N572K probably benign Het
Pikfyve T C 1: 65,267,877 V1808A possibly damaging Het
Pirt A C 11: 66,925,943 S27R probably damaging Het
Rgs17 A T 10: 5,841,488 D96E probably benign Het
Senp1 A G 15: 98,066,798 F206L probably benign Het
Sh3rf1 T A 8: 61,372,722 S584T probably benign Het
Tex44 A T 1: 86,426,737 K123* probably null Het
Tpst2 C A 5: 112,308,021 T142K probably damaging Het
Ttc28 G A 5: 111,285,219 G2040R possibly damaging Het
Uggt2 T A 14: 119,026,493 I1042F probably damaging Het
Vmn2r91 T C 17: 18,105,431 S104P probably damaging Het
Wdfy3 T C 5: 101,855,386 probably null Het
Zeb2 G A 2: 45,002,572 A223V probably damaging Het
Zfp566 A G 7: 30,078,505 S84P probably benign Het
Zfp994 T A 17: 22,201,755 H71L possibly damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense probably benign 0.01
R7570:Kndc1 UTSW 7 139923775 frame shift probably null
R7629:Kndc1 UTSW 7 139895260 missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139939838 missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139923816 missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139920964 missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139921486 missense probably benign 0.02
R8011:Kndc1 UTSW 7 139910620 missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139918844 missense probably benign 0.01
R8134:Kndc1 UTSW 7 139901369 splice site probably null
R8197:Kndc1 UTSW 7 139913531 missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139924045 missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139901205 missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139923753 missense probably benign 0.27
R8735:Kndc1 UTSW 7 139910214 missense probably benign 0.00
R8816:Kndc1 UTSW 7 139937996 missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139924061 missense possibly damaging 0.95
R8961:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9002:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139921441 missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139895224 missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139921476 missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9510:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9518:Kndc1 UTSW 7 139939914 missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139920704 missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139921912 missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139910813 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGAACCTCAGGCCCATTTTG -3'
(R):5'- AAGCCCTTACTCCTCAGCTTAG -3'

Sequencing Primer
(F):5'- TGTTCAGTGAGGTATTAGGCAAC -3'
(R):5'- CCTCAGCTTAGTCGACTTGTGG -3'
Posted On 2019-10-24