Incidental Mutation 'R7625:Cdc40'
ID589399
Institutional Source Beutler Lab
Gene Symbol Cdc40
Ensembl Gene ENSMUSG00000038446
Gene Namecell division cycle 40
SynonymsPRP17, 1200003H23Rik, EHB3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7625 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location40831621-40883311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40848052 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 247 (Y247N)
Ref Sequence ENSEMBL: ENSMUSP00000044305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044166]
Predicted Effect probably benign
Transcript: ENSMUST00000044166
AA Change: Y247N

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044305
Gene: ENSMUSG00000038446
AA Change: Y247N

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 224 238 N/A INTRINSIC
WD40 277 317 6.04e-8 SMART
WD40 321 360 8.1e-9 SMART
WD40 363 404 1.58e-2 SMART
WD40 407 446 9.52e-6 SMART
WD40 452 489 2.13e1 SMART
WD40 495 536 1.4e-3 SMART
WD40 539 579 3.37e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216025
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is found to be essential for the catalytic step II in pre-mRNA splicing process. It is found in the spliceosome, and contains seven WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp17 protein, which functions in two different cellular processes: pre-mRNA splicing and cell cycle progression. It suggests that this protein may play a role in cell cycle progression. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,046,955 V506E probably damaging Het
Acaa2 G T 18: 74,804,142 V366F possibly damaging Het
Ago1 G A 4: 126,443,229 R532C probably benign Het
Ank2 T G 3: 127,052,800 D182A probably damaging Het
Anxa4 T C 6: 86,737,819 D302G probably damaging Het
Apoa4 A T 9: 46,243,112 E337V probably damaging Het
Atf1 A G 15: 100,254,277 probably null Het
Atp8b3 A C 10: 80,520,146 V1244G probably benign Het
BC080695 A T 4: 143,572,251 I255L probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camk2a G A 18: 60,952,340 V132M probably damaging Het
Chd8 G A 14: 52,237,077 P166S probably benign Het
Chl1 T A 6: 103,729,125 S1140R probably damaging Het
Clstn3 G T 6: 124,437,418 S783* probably null Het
Col6a1 A G 10: 76,713,926 S562P unknown Het
Cpb2 G A 14: 75,272,549 V250M possibly damaging Het
Cyp2c38 T A 19: 39,462,924 Q44L possibly damaging Het
Dgat1 T C 15: 76,503,195 M325V possibly damaging Het
Dnah11 T A 12: 118,196,642 M118L probably benign Het
Dpy19l3 T A 7: 35,752,681 I13L probably benign Het
Enkd1 A G 8: 105,704,633 probably null Het
Fam241b A G 10: 62,134,700 probably benign Het
Fhit T A 14: 9,870,177 probably null Het
Gm21994 T C 2: 150,254,600 D303G probably benign Het
Gp6 T C 7: 4,370,174 E250G probably benign Het
Hmgb1 T C 5: 149,050,340 E84G probably benign Het
Hscb T A 5: 110,829,146 I227F probably damaging Het
Hspg2 T A 4: 137,564,938 L4047Q probably damaging Het
Hsph1 A G 5: 149,618,436 L775P probably benign Het
Hydin A T 8: 110,541,844 S2947C probably benign Het
Intu T C 3: 40,697,599 S829P probably benign Het
Kcnn3 C A 3: 89,609,670 T462K probably damaging Het
Kndc1 G A 7: 139,938,017 C1622Y possibly damaging Het
Lifr T C 15: 7,169,242 Y318H probably damaging Het
Mier2 A G 10: 79,542,709 S332P probably damaging Het
Mindy4 T C 6: 55,276,613 I489T possibly damaging Het
Mmp8 A T 9: 7,566,217 Q358L probably benign Het
Ms4a4a T A 19: 11,390,364 probably null Het
Nav1 G C 1: 135,467,745 S962C probably damaging Het
Nfe2l1 G A 11: 96,819,445 R653C probably damaging Het
Nod2 A T 8: 88,665,278 I738F probably damaging Het
Nrf1 G A 6: 30,116,231 V301I probably benign Het
Olfr424 G A 1: 174,137,167 C141Y probably benign Het
Olfr622 A G 7: 103,639,958 Y61H probably damaging Het
Oog1 T C 12: 87,608,312 F410S probably benign Het
Pcdhga8 G A 18: 37,726,901 V337I probably benign Het
Pdzd3 A T 9: 44,250,297 I95N probably damaging Het
Pelp1 G T 11: 70,395,434 N572K probably benign Het
Pikfyve T C 1: 65,267,877 V1808A possibly damaging Het
Pirt A C 11: 66,925,943 S27R probably damaging Het
Rgs17 A T 10: 5,841,488 D96E probably benign Het
Senp1 A G 15: 98,066,798 F206L probably benign Het
Sh3rf1 T A 8: 61,372,722 S584T probably benign Het
Tex44 A T 1: 86,426,737 K123* probably null Het
Tpst2 C A 5: 112,308,021 T142K probably damaging Het
Ttc28 G A 5: 111,285,219 G2040R possibly damaging Het
Uggt2 T A 14: 119,026,493 I1042F probably damaging Het
Vmn2r91 T C 17: 18,105,431 S104P probably damaging Het
Wdfy3 T C 5: 101,855,386 probably null Het
Zeb2 G A 2: 45,002,572 A223V probably damaging Het
Zfp566 A G 7: 30,078,505 S84P probably benign Het
Zfp994 T A 17: 22,201,755 H71L possibly damaging Het
Other mutations in Cdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Cdc40 APN 10 40843128 missense probably damaging 1.00
IGL02333:Cdc40 APN 10 40867859 missense probably benign 0.00
IGL02490:Cdc40 APN 10 40841771 missense probably benign 0.39
IGL02878:Cdc40 APN 10 40843122 missense probably damaging 0.96
IGL02976:Cdc40 APN 10 40882921 missense probably benign
IGL03058:Cdc40 APN 10 40849828 missense probably benign 0.01
IGL03178:Cdc40 APN 10 40847989 missense probably benign
R0409:Cdc40 UTSW 10 40847168 missense probably damaging 0.99
R0522:Cdc40 UTSW 10 40857612 missense probably benign 0.21
R0608:Cdc40 UTSW 10 40848052 missense probably benign 0.15
R0730:Cdc40 UTSW 10 40844956 splice site probably benign
R1712:Cdc40 UTSW 10 40841376 missense probably damaging 1.00
R1940:Cdc40 UTSW 10 40883071 unclassified probably benign
R4062:Cdc40 UTSW 10 40849852 splice site probably null
R5035:Cdc40 UTSW 10 40849813 missense probably benign 0.18
R5628:Cdc40 UTSW 10 40851053 missense probably benign 0.03
R6933:Cdc40 UTSW 10 40844996 missense probably damaging 0.96
R7082:Cdc40 UTSW 10 40867873 missense probably benign
R7419:Cdc40 UTSW 10 40841443 missense probably damaging 1.00
R7834:Cdc40 UTSW 10 40882949 missense probably benign 0.00
R7908:Cdc40 UTSW 10 40848046 missense probably damaging 1.00
R8031:Cdc40 UTSW 10 40852516 missense probably benign 0.00
R8131:Cdc40 UTSW 10 40841477 missense possibly damaging 0.45
RF041:Cdc40 UTSW 10 40843123 missense probably damaging 1.00
X0026:Cdc40 UTSW 10 40841452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAAGCTCTGAACTGGCTTC -3'
(R):5'- CCTGCCTTTTAGTGTAGTGATAGAAAG -3'

Sequencing Primer
(F):5'- GAAGCTCTGAACTGGCTTCTCTTTG -3'
(R):5'- GAACTCTGAGAGCATAATTTTAGCC -3'
Posted On2019-10-24