Incidental Mutation 'R7625:Uggt2'
ID 589413
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene Name UDP-glucose glycoprotein glucosyltransferase 2
Synonyms 3110001A05Rik, A230065J02Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2
MMRRC Submission 045719-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R7625 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 119222451-119336842 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119263905 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1042 (I1042F)
Ref Sequence ENSEMBL: ENSMUSP00000121249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127153] [ENSMUST00000156203]
AlphaFold E9Q4X2
Predicted Effect probably benign
Transcript: ENSMUST00000127153
SMART Domains Protein: ENSMUSP00000117738
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
low complexity region 327 334 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123327
Gene: ENSMUSG00000042104
AA Change: I80F

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 1 106 3.3e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156203
AA Change: I1042F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104
AA Change: I1042F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 T A 8: 111,773,587 (GRCm39) V506E probably damaging Het
Acaa2 G T 18: 74,937,213 (GRCm39) V366F possibly damaging Het
Ago1 G A 4: 126,337,022 (GRCm39) R532C probably benign Het
Ank2 T G 3: 126,846,449 (GRCm39) D182A probably damaging Het
Anxa4 T C 6: 86,714,801 (GRCm39) D302G probably damaging Het
Apoa4 A T 9: 46,154,410 (GRCm39) E337V probably damaging Het
Atf1 A G 15: 100,152,158 (GRCm39) probably null Het
Atp8b3 A C 10: 80,355,980 (GRCm39) V1244G probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,157,152 (GRCm39) probably benign Het
Camk2a G A 18: 61,085,412 (GRCm39) V132M probably damaging Het
Cdc40 A T 10: 40,724,048 (GRCm39) Y247N probably benign Het
Chd8 G A 14: 52,474,534 (GRCm39) P166S probably benign Het
Chl1 T A 6: 103,706,086 (GRCm39) S1140R probably damaging Het
Clstn3 G T 6: 124,414,377 (GRCm39) S783* probably null Het
Col6a1 A G 10: 76,549,760 (GRCm39) S562P unknown Het
Cpb2 G A 14: 75,509,989 (GRCm39) V250M possibly damaging Het
Cyp2c38 T A 19: 39,451,368 (GRCm39) Q44L possibly damaging Het
Dgat1 T C 15: 76,387,395 (GRCm39) M325V possibly damaging Het
Dnah11 T A 12: 118,160,377 (GRCm39) M118L probably benign Het
Dpy19l3 T A 7: 35,452,106 (GRCm39) I13L probably benign Het
Enkd1 A G 8: 106,431,265 (GRCm39) probably null Het
Fam241b A G 10: 61,970,479 (GRCm39) probably benign Het
Fhit T A 14: 9,870,177 (GRCm38) probably null Het
Gp6 T C 7: 4,373,173 (GRCm39) E250G probably benign Het
Hmgb1 T C 5: 148,987,150 (GRCm39) E84G probably benign Het
Hscb T A 5: 110,977,012 (GRCm39) I227F probably damaging Het
Hspg2 T A 4: 137,292,249 (GRCm39) L4047Q probably damaging Het
Hsph1 A G 5: 149,541,901 (GRCm39) L775P probably benign Het
Hydin A T 8: 111,268,476 (GRCm39) S2947C probably benign Het
Intu T C 3: 40,652,029 (GRCm39) S829P probably benign Het
Kcnn3 C A 3: 89,516,977 (GRCm39) T462K probably damaging Het
Kndc1 G A 7: 139,517,930 (GRCm39) C1622Y possibly damaging Het
Lifr T C 15: 7,198,723 (GRCm39) Y318H probably damaging Het
Mier2 A G 10: 79,378,543 (GRCm39) S332P probably damaging Het
Mindy4 T C 6: 55,253,598 (GRCm39) I489T possibly damaging Het
Mmp8 A T 9: 7,566,218 (GRCm39) Q358L probably benign Het
Ms4a4a T A 19: 11,367,728 (GRCm39) probably null Het
Nav1 G C 1: 135,395,483 (GRCm39) S962C probably damaging Het
Nfe2l1 G A 11: 96,710,271 (GRCm39) R653C probably damaging Het
Nherf4 A T 9: 44,161,594 (GRCm39) I95N probably damaging Het
Nod2 A T 8: 89,391,906 (GRCm39) I738F probably damaging Het
Nrf1 G A 6: 30,116,230 (GRCm39) V301I probably benign Het
Oog1 T C 12: 87,655,082 (GRCm39) F410S probably benign Het
Or52a33 A G 7: 103,289,165 (GRCm39) Y61H probably damaging Het
Or6k4 G A 1: 173,964,733 (GRCm39) C141Y probably benign Het
Pcdhga8 G A 18: 37,859,954 (GRCm39) V337I probably benign Het
Pelp1 G T 11: 70,286,260 (GRCm39) N572K probably benign Het
Pikfyve T C 1: 65,307,036 (GRCm39) V1808A possibly damaging Het
Pirt A C 11: 66,816,769 (GRCm39) S27R probably damaging Het
Pramel20 A T 4: 143,298,821 (GRCm39) I255L probably benign Het
Rgs17 A T 10: 5,791,488 (GRCm39) D96E probably benign Het
Senp1 A G 15: 97,964,679 (GRCm39) F206L probably benign Het
Sh3rf1 T A 8: 61,825,756 (GRCm39) S584T probably benign Het
Tex44 A T 1: 86,354,459 (GRCm39) K123* probably null Het
Tpst2 C A 5: 112,455,887 (GRCm39) T142K probably damaging Het
Ttc28 G A 5: 111,433,085 (GRCm39) G2040R possibly damaging Het
Vmn2r91 T C 17: 18,325,693 (GRCm39) S104P probably damaging Het
Wdfy3 T C 5: 102,003,252 (GRCm39) probably null Het
Zeb2 G A 2: 44,892,584 (GRCm39) A223V probably damaging Het
Zfp1002 T C 2: 150,096,520 (GRCm39) D303G probably benign Het
Zfp566 A G 7: 29,777,930 (GRCm39) S84P probably benign Het
Zfp994 T A 17: 22,420,736 (GRCm39) H71L possibly damaging Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119,286,688 (GRCm39) missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119,263,841 (GRCm39) nonsense probably null
IGL00433:Uggt2 APN 14 119,250,899 (GRCm39) missense probably benign
IGL00572:Uggt2 APN 14 119,280,203 (GRCm39) missense probably benign 0.02
IGL00577:Uggt2 APN 14 119,272,312 (GRCm39) missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119,280,211 (GRCm39) missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119,295,057 (GRCm39) missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119,280,184 (GRCm39) missense probably benign 0.00
IGL01787:Uggt2 APN 14 119,319,146 (GRCm39) missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119,326,605 (GRCm39) missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119,328,150 (GRCm39) missense probably benign 0.17
IGL02894:Uggt2 APN 14 119,319,211 (GRCm39) missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119,312,758 (GRCm39) missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119,332,722 (GRCm39) missense probably benign 0.25
IGL03142:Uggt2 APN 14 119,235,603 (GRCm39) missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119,315,080 (GRCm39) missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119,308,300 (GRCm39) missense probably benign 0.38
P0014:Uggt2 UTSW 14 119,281,950 (GRCm39) missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119,287,075 (GRCm39) missense probably benign 0.07
R0063:Uggt2 UTSW 14 119,244,542 (GRCm39) splice site probably benign
R0063:Uggt2 UTSW 14 119,244,542 (GRCm39) splice site probably benign
R0383:Uggt2 UTSW 14 119,286,863 (GRCm39) missense probably damaging 1.00
R0433:Uggt2 UTSW 14 119,312,741 (GRCm39) critical splice donor site probably null
R0472:Uggt2 UTSW 14 119,332,748 (GRCm39) missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119,332,748 (GRCm39) missense probably damaging 1.00
R0645:Uggt2 UTSW 14 119,295,010 (GRCm39) missense probably benign 0.27
R0788:Uggt2 UTSW 14 119,332,812 (GRCm39) splice site probably benign
R0940:Uggt2 UTSW 14 119,328,604 (GRCm39) critical splice donor site probably null
R1567:Uggt2 UTSW 14 119,246,505 (GRCm39) missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119,295,075 (GRCm39) missense possibly damaging 0.95
R1682:Uggt2 UTSW 14 119,292,055 (GRCm39) missense probably benign 0.19
R1746:Uggt2 UTSW 14 119,250,915 (GRCm39) missense probably benign 0.00
R1785:Uggt2 UTSW 14 119,298,788 (GRCm39) missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119,298,788 (GRCm39) missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119,269,688 (GRCm39) missense probably benign 0.00
R1894:Uggt2 UTSW 14 119,287,130 (GRCm39) missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119,245,467 (GRCm39) splice site probably benign
R2149:Uggt2 UTSW 14 119,312,757 (GRCm39) missense probably benign 0.02
R2168:Uggt2 UTSW 14 119,256,917 (GRCm39) missense probably damaging 1.00
R2219:Uggt2 UTSW 14 119,312,749 (GRCm39) missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119,312,749 (GRCm39) missense probably damaging 1.00
R2240:Uggt2 UTSW 14 119,232,461 (GRCm39) missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119,264,011 (GRCm39) missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119,296,521 (GRCm39) missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2907:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2908:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2998:Uggt2 UTSW 14 119,286,797 (GRCm39) missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119,328,682 (GRCm39) missense probably benign 0.39
R3722:Uggt2 UTSW 14 119,278,930 (GRCm39) missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119,295,084 (GRCm39) missense probably benign 0.13
R4015:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119,286,674 (GRCm39) missense probably damaging 1.00
R4536:Uggt2 UTSW 14 119,256,970 (GRCm39) missense probably benign
R4642:Uggt2 UTSW 14 119,272,347 (GRCm39) missense probably benign 0.00
R4654:Uggt2 UTSW 14 119,269,670 (GRCm39) missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119,266,466 (GRCm39) splice site probably null
R4810:Uggt2 UTSW 14 119,250,933 (GRCm39) missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119,239,259 (GRCm39) missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119,273,376 (GRCm39) splice site probably null
R4886:Uggt2 UTSW 14 119,273,376 (GRCm39) splice site probably null
R4888:Uggt2 UTSW 14 119,315,062 (GRCm39) critical splice donor site probably null
R4888:Uggt2 UTSW 14 119,286,665 (GRCm39) missense probably damaging 1.00
R4895:Uggt2 UTSW 14 119,256,298 (GRCm39) missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119,319,182 (GRCm39) missense probably benign 0.00
R5423:Uggt2 UTSW 14 119,256,898 (GRCm39) missense probably damaging 1.00
R5476:Uggt2 UTSW 14 119,328,121 (GRCm39) missense probably benign 0.01
R5561:Uggt2 UTSW 14 119,278,939 (GRCm39) missense probably benign 0.02
R5607:Uggt2 UTSW 14 119,326,611 (GRCm39) missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119,326,611 (GRCm39) missense possibly damaging 0.81
R5625:Uggt2 UTSW 14 119,315,136 (GRCm39) missense probably damaging 1.00
R5698:Uggt2 UTSW 14 119,280,138 (GRCm39) missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119,286,838 (GRCm39) missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119,308,238 (GRCm39) missense probably benign 0.06
R6031:Uggt2 UTSW 14 119,308,238 (GRCm39) missense probably benign 0.06
R6056:Uggt2 UTSW 14 119,273,381 (GRCm39) critical splice donor site probably null
R6289:Uggt2 UTSW 14 119,279,014 (GRCm39) missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119,294,976 (GRCm39) missense probably benign 0.01
R6515:Uggt2 UTSW 14 119,315,131 (GRCm39) missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119,308,293 (GRCm39) missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119,280,022 (GRCm39) missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119,263,847 (GRCm39) missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119,239,271 (GRCm39) missense probably benign 0.10
R7117:Uggt2 UTSW 14 119,251,938 (GRCm39) missense probably benign 0.25
R7183:Uggt2 UTSW 14 119,257,049 (GRCm39) splice site probably null
R7337:Uggt2 UTSW 14 119,323,587 (GRCm39) missense probably benign 0.28
R7342:Uggt2 UTSW 14 119,232,384 (GRCm39) missense possibly damaging 0.56
R7615:Uggt2 UTSW 14 119,326,681 (GRCm39) missense probably benign 0.12
R7685:Uggt2 UTSW 14 119,312,759 (GRCm39) missense probably damaging 1.00
R7842:Uggt2 UTSW 14 119,235,516 (GRCm39) missense probably damaging 1.00
R7891:Uggt2 UTSW 14 119,280,059 (GRCm39) missense probably benign 0.09
R7938:Uggt2 UTSW 14 119,296,519 (GRCm39) missense possibly damaging 0.68
R8050:Uggt2 UTSW 14 119,263,834 (GRCm39) missense probably damaging 0.98
R9007:Uggt2 UTSW 14 119,326,724 (GRCm39) missense probably damaging 1.00
R9080:Uggt2 UTSW 14 119,295,017 (GRCm39) missense probably benign 0.42
R9203:Uggt2 UTSW 14 119,294,975 (GRCm39) missense probably benign 0.08
R9215:Uggt2 UTSW 14 119,279,006 (GRCm39) missense probably damaging 1.00
R9324:Uggt2 UTSW 14 119,312,741 (GRCm39) critical splice donor site probably null
R9459:Uggt2 UTSW 14 119,286,595 (GRCm39) missense probably benign 0.02
R9647:Uggt2 UTSW 14 119,256,312 (GRCm39) missense probably damaging 1.00
R9781:Uggt2 UTSW 14 119,232,384 (GRCm39) missense possibly damaging 0.56
Z1177:Uggt2 UTSW 14 119,244,708 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGCATGGCTTGAAAGTAG -3'
(R):5'- AGGGCTGCAGAAATTAGCAC -3'

Sequencing Primer
(F):5'- CGCATGGCTTGAAAGTAGAAGTAAG -3'
(R):5'- GGCTGCAGAAATTAGCACAGATACTC -3'
Posted On 2019-10-24