Incidental Mutation 'R7625:Vmn2r91'
ID589417
Institutional Source Beutler Lab
Gene Symbol Vmn2r91
Ensembl Gene ENSMUSG00000091206
Gene Namevomeronasal 2, receptor 91
SynonymsEG665210
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7625 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18085057-18136643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18105431 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 104 (S104P)
Ref Sequence ENSEMBL: ENSMUSP00000127465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172359]
Predicted Effect probably damaging
Transcript: ENSMUST00000172359
AA Change: S104P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127465
Gene: ENSMUSG00000091206
AA Change: S104P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 462 2.2e-38 PFAM
Pfam:NCD3G 510 564 6.7e-20 PFAM
Pfam:7tm_3 597 832 2.1e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,046,955 V506E probably damaging Het
Acaa2 G T 18: 74,804,142 V366F possibly damaging Het
Ago1 G A 4: 126,443,229 R532C probably benign Het
Ank2 T G 3: 127,052,800 D182A probably damaging Het
Anxa4 T C 6: 86,737,819 D302G probably damaging Het
Apoa4 A T 9: 46,243,112 E337V probably damaging Het
Atp8b3 A C 10: 80,520,146 V1244G probably benign Het
BC080695 A T 4: 143,572,251 I255L probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camk2a G A 18: 60,952,340 V132M probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Chd8 G A 14: 52,237,077 P166S probably benign Het
Chl1 T A 6: 103,729,125 S1140R probably damaging Het
Clstn3 G T 6: 124,437,418 S783* probably null Het
Col6a1 A G 10: 76,713,926 S562P unknown Het
Cpb2 G A 14: 75,272,549 V250M possibly damaging Het
Cyp2c38 T A 19: 39,462,924 Q44L possibly damaging Het
Dgat1 T C 15: 76,503,195 M325V possibly damaging Het
Dnah11 T A 12: 118,196,642 M118L probably benign Het
Dpy19l3 T A 7: 35,752,681 I13L probably benign Het
Enkd1 A G 8: 105,704,633 probably null Het
Fam241b A G 10: 62,134,700 probably benign Het
Fhit T A 14: 9,870,177 probably null Het
Gm21994 T C 2: 150,254,600 D303G probably benign Het
Gp6 T C 7: 4,370,174 E250G probably benign Het
Hmgb1 T C 5: 149,050,340 E84G probably benign Het
Hscb T A 5: 110,829,146 I227F probably damaging Het
Hspg2 T A 4: 137,564,938 L4047Q probably damaging Het
Hsph1 A G 5: 149,618,436 L775P probably benign Het
Hydin A T 8: 110,541,844 S2947C probably benign Het
Intu T C 3: 40,697,599 S829P probably benign Het
Kcnn3 C A 3: 89,609,670 T462K probably damaging Het
Kndc1 G A 7: 139,938,017 C1622Y possibly damaging Het
Lifr T C 15: 7,169,242 Y318H probably damaging Het
Mier2 A G 10: 79,542,709 S332P probably damaging Het
Mindy4 T C 6: 55,276,613 I489T possibly damaging Het
Mmp8 A T 9: 7,566,217 Q358L probably benign Het
Ms4a4a T A 19: 11,390,364 probably null Het
Nav1 G C 1: 135,467,745 S962C probably damaging Het
Nfe2l1 G A 11: 96,819,445 R653C probably damaging Het
Nod2 A T 8: 88,665,278 I738F probably damaging Het
Nrf1 G A 6: 30,116,231 V301I probably benign Het
Olfr424 G A 1: 174,137,167 C141Y probably benign Het
Olfr622 A G 7: 103,639,958 Y61H probably damaging Het
Oog1 T C 12: 87,608,312 F410S probably benign Het
Pcdhga8 G A 18: 37,726,901 V337I probably benign Het
Pdzd3 A T 9: 44,250,297 I95N probably damaging Het
Pelp1 G T 11: 70,395,434 N572K probably benign Het
Pikfyve T C 1: 65,267,877 V1808A possibly damaging Het
Pirt A C 11: 66,925,943 S27R probably damaging Het
Rgs17 A T 10: 5,841,488 D96E probably benign Het
Senp1 A G 15: 98,066,798 F206L probably benign Het
Sh3rf1 T A 8: 61,372,722 S584T probably benign Het
Tex44 A T 1: 86,426,737 K123* probably null Het
Tpst2 C A 5: 112,308,021 T142K probably damaging Het
Ttc28 G A 5: 111,285,219 G2040R possibly damaging Het
Uggt2 T A 14: 119,026,493 I1042F probably damaging Het
Zeb2 G A 2: 45,002,572 A223V probably damaging Het
Zfp566 A G 7: 30,078,505 S84P probably benign Het
Zfp994 T A 17: 22,201,755 H71L possibly damaging Het
Other mutations in Vmn2r91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Vmn2r91 APN 17 18105558 missense probably benign 0.00
IGL01121:Vmn2r91 APN 17 18136504 missense possibly damaging 0.94
IGL01464:Vmn2r91 APN 17 18107602 missense probably null 0.00
IGL02003:Vmn2r91 APN 17 18107659 missense probably benign
IGL02709:Vmn2r91 APN 17 18105449 missense possibly damaging 0.74
IGL02795:Vmn2r91 APN 17 18085277 missense probably benign 0.01
IGL02813:Vmn2r91 APN 17 18136086 missense possibly damaging 0.91
IGL02830:Vmn2r91 APN 17 18136622 missense probably benign 0.01
IGL03130:Vmn2r91 APN 17 18110111 splice site probably benign
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0393:Vmn2r91 UTSW 17 18105450 missense probably damaging 1.00
R1142:Vmn2r91 UTSW 17 18136443 missense probably damaging 1.00
R1603:Vmn2r91 UTSW 17 18106143 missense probably benign 0.04
R1992:Vmn2r91 UTSW 17 18135880 missense probably damaging 1.00
R2182:Vmn2r91 UTSW 17 18105429 missense possibly damaging 0.94
R2424:Vmn2r91 UTSW 17 18136169 nonsense probably null
R2512:Vmn2r91 UTSW 17 18135786 missense probably benign
R2885:Vmn2r91 UTSW 17 18105366 missense probably benign 0.00
R2909:Vmn2r91 UTSW 17 18136399 missense probably damaging 1.00
R3009:Vmn2r91 UTSW 17 18105455 missense probably benign 0.11
R3079:Vmn2r91 UTSW 17 18135711 splice site probably null
R3080:Vmn2r91 UTSW 17 18135711 splice site probably null
R3434:Vmn2r91 UTSW 17 18110108 splice site probably benign
R3723:Vmn2r91 UTSW 17 18085278 critical splice donor site probably null
R3829:Vmn2r91 UTSW 17 18105497 missense probably damaging 1.00
R3845:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R3846:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R4118:Vmn2r91 UTSW 17 18110096 missense probably damaging 1.00
R4285:Vmn2r91 UTSW 17 18135768 missense probably benign 0.00
R4729:Vmn2r91 UTSW 17 18107644 missense probably damaging 1.00
R4793:Vmn2r91 UTSW 17 18105396 missense probably damaging 1.00
R4932:Vmn2r91 UTSW 17 18136489 missense possibly damaging 0.84
R5016:Vmn2r91 UTSW 17 18110060 nonsense probably null
R5018:Vmn2r91 UTSW 17 18136438 missense probably damaging 1.00
R5605:Vmn2r91 UTSW 17 18136501 missense probably damaging 1.00
R5815:Vmn2r91 UTSW 17 18106202 missense probably benign 0.01
R6146:Vmn2r91 UTSW 17 18136256 missense probably benign 0.07
R6187:Vmn2r91 UTSW 17 18106626 missense probably benign 0.05
R6426:Vmn2r91 UTSW 17 18135603 intron probably null
R6450:Vmn2r91 UTSW 17 18085265 missense probably damaging 0.98
R6767:Vmn2r91 UTSW 17 18107545 missense probably damaging 0.98
R6986:Vmn2r91 UTSW 17 18136009 missense probably benign 0.10
R7112:Vmn2r91 UTSW 17 18105618 missense possibly damaging 0.83
R7178:Vmn2r91 UTSW 17 18136162 missense probably damaging 1.00
R7330:Vmn2r91 UTSW 17 18106167 missense probably damaging 1.00
R7368:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7380:Vmn2r91 UTSW 17 18136576 nonsense probably null
R7397:Vmn2r91 UTSW 17 18135798 missense probably benign 0.02
R7739:Vmn2r91 UTSW 17 18135818 missense probably benign 0.00
R7749:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7755:Vmn2r91 UTSW 17 18110049 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATGTGCTTGCCTAAATCTAACG -3'
(R):5'- TTGAAGCAATGTCCCAATTTGG -3'

Sequencing Primer
(F):5'- GTGCTTGCCTAAATCTAACGTATTC -3'
(R):5'- CCAATTTGGGCAGATGTTTTCC -3'
Posted On2019-10-24