Incidental Mutation 'R7625:Cyp2c38'
ID589423
Institutional Source Beutler Lab
Gene Symbol Cyp2c38
Ensembl Gene ENSMUSG00000032808
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 38
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7625 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location39389556-39463075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39462924 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 44 (Q44L)
Ref Sequence ENSEMBL: ENSMUSP00000044722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035488]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035488
AA Change: Q44L

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044722
Gene: ENSMUSG00000032808
AA Change: Q44L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 1.5e-161 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,046,955 V506E probably damaging Het
Acaa2 G T 18: 74,804,142 V366F possibly damaging Het
Ago1 G A 4: 126,443,229 R532C probably benign Het
Ank2 T G 3: 127,052,800 D182A probably damaging Het
Anxa4 T C 6: 86,737,819 D302G probably damaging Het
Apoa4 A T 9: 46,243,112 E337V probably damaging Het
Atp8b3 A C 10: 80,520,146 V1244G probably benign Het
BC080695 A T 4: 143,572,251 I255L probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camk2a G A 18: 60,952,340 V132M probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Chd8 G A 14: 52,237,077 P166S probably benign Het
Chl1 T A 6: 103,729,125 S1140R probably damaging Het
Clstn3 G T 6: 124,437,418 S783* probably null Het
Col6a1 A G 10: 76,713,926 S562P unknown Het
Cpb2 G A 14: 75,272,549 V250M possibly damaging Het
Dgat1 T C 15: 76,503,195 M325V possibly damaging Het
Dnah11 T A 12: 118,196,642 M118L probably benign Het
Dpy19l3 T A 7: 35,752,681 I13L probably benign Het
Enkd1 A G 8: 105,704,633 probably null Het
Fam241b A G 10: 62,134,700 probably benign Het
Fhit T A 14: 9,870,177 probably null Het
Gm21994 T C 2: 150,254,600 D303G probably benign Het
Gp6 T C 7: 4,370,174 E250G probably benign Het
Hmgb1 T C 5: 149,050,340 E84G probably benign Het
Hscb T A 5: 110,829,146 I227F probably damaging Het
Hspg2 T A 4: 137,564,938 L4047Q probably damaging Het
Hsph1 A G 5: 149,618,436 L775P probably benign Het
Hydin A T 8: 110,541,844 S2947C probably benign Het
Intu T C 3: 40,697,599 S829P probably benign Het
Kcnn3 C A 3: 89,609,670 T462K probably damaging Het
Kndc1 G A 7: 139,938,017 C1622Y possibly damaging Het
Lifr T C 15: 7,169,242 Y318H probably damaging Het
Mier2 A G 10: 79,542,709 S332P probably damaging Het
Mindy4 T C 6: 55,276,613 I489T possibly damaging Het
Mmp8 A T 9: 7,566,217 Q358L probably benign Het
Ms4a4a T A 19: 11,390,364 probably null Het
Nav1 G C 1: 135,467,745 S962C probably damaging Het
Nfe2l1 G A 11: 96,819,445 R653C probably damaging Het
Nod2 A T 8: 88,665,278 I738F probably damaging Het
Nrf1 G A 6: 30,116,231 V301I probably benign Het
Olfr424 G A 1: 174,137,167 C141Y probably benign Het
Olfr622 A G 7: 103,639,958 Y61H probably damaging Het
Oog1 T C 12: 87,608,312 F410S probably benign Het
Pcdhga8 G A 18: 37,726,901 V337I probably benign Het
Pdzd3 A T 9: 44,250,297 I95N probably damaging Het
Pelp1 G T 11: 70,395,434 N572K probably benign Het
Pikfyve T C 1: 65,267,877 V1808A possibly damaging Het
Pirt A C 11: 66,925,943 S27R probably damaging Het
Rgs17 A T 10: 5,841,488 D96E probably benign Het
Senp1 A G 15: 98,066,798 F206L probably benign Het
Sh3rf1 T A 8: 61,372,722 S584T probably benign Het
Tex44 A T 1: 86,426,737 K123* probably null Het
Tpst2 C A 5: 112,308,021 T142K probably damaging Het
Ttc28 G A 5: 111,285,219 G2040R possibly damaging Het
Uggt2 T A 14: 119,026,493 I1042F probably damaging Het
Vmn2r91 T C 17: 18,105,431 S104P probably damaging Het
Zeb2 G A 2: 45,002,572 A223V probably damaging Het
Zfp566 A G 7: 30,078,505 S84P probably benign Het
Zfp994 T A 17: 22,201,755 H71L possibly damaging Het
Other mutations in Cyp2c38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Cyp2c38 APN 19 39460725 nonsense probably null
IGL01109:Cyp2c38 APN 19 39462885 critical splice donor site probably null
IGL01521:Cyp2c38 APN 19 39460670 missense probably damaging 0.99
IGL02036:Cyp2c38 APN 19 39460316 missense probably null 0.97
IGL02187:Cyp2c38 APN 19 39436205 missense probably benign 0.14
IGL02954:Cyp2c38 APN 19 39391076 missense probably damaging 0.99
R0479:Cyp2c38 UTSW 19 39463005 missense probably damaging 0.99
R0684:Cyp2c38 UTSW 19 39391056 missense probably damaging 0.99
R0919:Cyp2c38 UTSW 19 39404669 missense probably benign 0.07
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1642:Cyp2c38 UTSW 19 39401709 missense probably damaging 1.00
R1715:Cyp2c38 UTSW 19 39404795 missense probably benign 0.25
R1900:Cyp2c38 UTSW 19 39438312 missense probably benign 0.40
R1954:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R1955:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R2860:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2861:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2862:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R3084:Cyp2c38 UTSW 19 39401701 missense probably benign 0.00
R3727:Cyp2c38 UTSW 19 39392295 splice site probably benign
R4648:Cyp2c38 UTSW 19 39460688 missense probably benign 0.05
R5119:Cyp2c38 UTSW 19 39460621 missense probably damaging 1.00
R5636:Cyp2c38 UTSW 19 39438306 nonsense probably null
R5651:Cyp2c38 UTSW 19 39460712 missense probably damaging 0.99
R6263:Cyp2c38 UTSW 19 39392215 missense probably damaging 1.00
R6384:Cyp2c38 UTSW 19 39392293 splice site probably null
R6853:Cyp2c38 UTSW 19 39438304 missense probably benign 0.02
R6915:Cyp2c38 UTSW 19 39436068 missense probably damaging 0.99
R7201:Cyp2c38 UTSW 19 39401776 missense probably damaging 1.00
R7570:Cyp2c38 UTSW 19 39404743 missense possibly damaging 0.76
R7666:Cyp2c38 UTSW 19 39438242 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TTACTCTCTTTCTGACAAGTGCCAG -3'
(R):5'- TGCTATAAAAGATCAGTGGTGCC -3'

Sequencing Primer
(F):5'- TTCTGACAAGTGCCAGCTGTAAAAG -3'
(R):5'- AGATCAGTGGTGCCTGATCTCAAC -3'
Posted On2019-10-24