Mutagenetix > Incidental Mutations

Incidental Mutation 'R7626:Lct'

589425

Institutional Source

Beutler Lab

Gene Symbol

Lct

Ensembl Gene

ENSMUSG00000026354

Gene Name

lactase

Synonyms

LPH, LOC226413, Lphl

MMRRC Submission

Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7626 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128284756-128328318 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128285195 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1907 (Y1907C)

Ref Sequence

ENSEMBL: ENSMUSP00000073190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073490]

Predicted Effect

probably damaging
Transcript: ENSMUST00000073490
AA Change: Y1907C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: Y1907C

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	76	226	1.6e-19	PFAM
low complexity region	322	340	N/A	INTRINSIC
Pfam:Glyco_hydro_1	380	849	4.8e-169	PFAM
low complexity region	865	875	N/A	INTRINSIC
Pfam:Glyco_hydro_1	902	1368	3.7e-181	PFAM
Pfam:Glyco_hydro_1	1377	1844	6.9e-183	PFAM
transmembrane domain	1885	1907	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162067

Meta Mutation Damage Score

0.1282

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Alox5	T	C	6: 116,413,795	D465G	possibly damaging	Het
Arhgef16	T	A	4: 154,282,882	K355N	possibly damaging	Het
C87499	A	T	4: 88,630,042	I42N	probably damaging	Het
Camkk2	T	A	5: 122,764,300		probably benign	Het
Ccdc171	C	T	4: 83,580,775	Q237*	probably null	Het
Ces2b	T	C	8: 104,837,385	Y464H	possibly damaging	Het
Cntfr	A	G	4: 41,662,013	F243S	possibly damaging	Het
Crip3	A	T	17: 46,429,865	R65S	probably benign	Het
Dcn	A	G	10: 97,483,478	Y39C	possibly damaging	Het
Degs2	T	C	12: 108,692,073	S216G	possibly damaging	Het
Dmxl1	A	G	18: 49,902,794	I2295V	probably benign	Het
Dnah2	A	G	11: 69,498,685	S794P	probably damaging	Het
Eri1	A	C	8: 35,474,400	Y264*	probably null	Het
Etl4	T	C	2: 20,713,378	L179P	probably damaging	Het
F5	T	G	1: 164,186,912	M584R	possibly damaging	Het
Fam98c	G	T	7: 29,152,823	R104S	probably damaging	Het
Flad1	A	T	3: 89,403,411	I443N	probably benign	Het
Hbp1	T	C	12: 31,943,900	E43G	probably benign	Het
Hivep3	CGG	CG	4: 120,097,911		probably null	Het
Kcnj3	T	A	2: 55,594,821	C310*	probably null	Het
Loxhd1	T	C	18: 77,431,186	V1896A	possibly damaging	Het
Lrfn4	C	A	19: 4,613,651	R285L	probably damaging	Het
Ltb4r2	T	A	14: 55,762,881	S320T	probably damaging	Het
Mmd	G	T	11: 90,257,552	R20L	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Nbas	T	C	12: 13,558,660	S2146P	probably benign	Het
Nop14	A	G	5: 34,651,791	F319L	probably damaging	Het
Numa1	C	A	7: 101,999,423	T787K	probably benign	Het
Olfr1495	T	G	19: 13,768,345	M1R	probably null	Het
Olfr325	A	C	11: 58,581,173	T110P	probably damaging	Het
Olfr784	T	G	10: 129,387,857	C75G	possibly damaging	Het
Patj	T	C	4: 98,546,987	V2A	probably benign	Het
Pisd	T	C	5: 32,740,688	H52R	probably benign	Het
Plekhg6	A	T	6: 125,363,668	D576E	probably benign	Het
Plekhn1	T	A	4: 156,225,653	H68L	probably benign	Het
Ppp1r37	T	A	7: 19,561,853	I60F	probably damaging	Het
Ppp2r1b	C	T	9: 50,878,176	T513M	possibly damaging	Het
Rhobtb2	C	A	14: 69,796,937	A280S	probably damaging	Het
Rnf40	A	G	7: 127,589,875	D140G	probably benign	Het
Rxfp1	A	G	3: 79,648,090	L653P	probably damaging	Het
Satb1	A	T	17: 51,767,967	D500E	probably benign	Het
Slc15a1	A	T	14: 121,475,965	D383E	probably benign	Het
Smarcad1	C	A	6: 65,096,049	S604R	possibly damaging	Het
St7	A	G	6: 17,934,217	T533A	probably damaging	Het
Sv2c	T	A	13: 95,985,943	T442S	probably benign	Het
Tbx2	A	G	11: 85,840,796	T640A	probably benign	Het
Tenm4	T	A	7: 96,893,014	N1948K	probably damaging	Het
Tonsl	A	T	15: 76,633,936	L582Q	probably null	Het
Unc13c	T	A	9: 73,734,517	K1231N	probably damaging	Het
Vmn2r101	T	A	17: 19,611,930	Y729*	probably null	Het
Zcchc2	A	G	1: 106,001,012	T334A	possibly damaging	Het
Zfp655	T	C	5: 145,237,107	L136P	probably damaging	Het
Zfp729a	A	T	13: 67,620,318	C597*	probably null	Het

Other mutations in Lct

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Lct	APN	1	128287556	missense	probably benign	0.09
IGL00970:Lct	APN	1	128304068	missense	probably damaging	1.00
IGL01022:Lct	APN	1	128300859	missense	probably benign
IGL01878:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL01892:Lct	APN	1	128307605	missense	probably damaging	1.00
IGL02307:Lct	APN	1	128286590	missense	possibly damaging	0.70
IGL02434:Lct	APN	1	128303790	missense	probably damaging	0.97
IGL02559:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL02623:Lct	APN	1	128308251	missense	probably benign	0.01
IGL02818:Lct	APN	1	128300168	missense	probably damaging	1.00
IGL02949:Lct	APN	1	128313132	missense	probably benign	0.26
IGL02951:Lct	APN	1	128300211	missense	probably damaging	1.00
IGL03087:Lct	APN	1	128300375	missense	possibly damaging	0.81
IGL03227:Lct	APN	1	128327689	missense	probably benign	0.09
ANU18:Lct	UTSW	1	128308047	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0135:Lct	UTSW	1	128285123	missense	probably damaging	0.98
R0145:Lct	UTSW	1	128327895	missense	probably benign	0.00
R0179:Lct	UTSW	1	128327685	missense	probably benign
R0331:Lct	UTSW	1	128298742	splice site	probably benign
R0366:Lct	UTSW	1	128286462	missense	probably benign	0.03
R0399:Lct	UTSW	1	128300525	missense	probably damaging	1.00
R0492:Lct	UTSW	1	128300582	missense	probably damaging	1.00
R0548:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R0691:Lct	UTSW	1	128308234	missense	probably benign	0.00
R0755:Lct	UTSW	1	128294135	missense	possibly damaging	0.46
R0839:Lct	UTSW	1	128286609	missense	probably benign	0.00
R1128:Lct	UTSW	1	128301309	missense	probably damaging	0.99
R1135:Lct	UTSW	1	128294124	critical splice donor site	probably null
R1321:Lct	UTSW	1	128300022	missense	probably benign
R1448:Lct	UTSW	1	128307822	missense	probably damaging	0.99
R1450:Lct	UTSW	1	128307903	missense	probably damaging	1.00
R1572:Lct	UTSW	1	128294195	missense	probably benign	0.25
R1582:Lct	UTSW	1	128300562	missense	probably damaging	1.00
R1668:Lct	UTSW	1	128287722	splice site	probably null
R1757:Lct	UTSW	1	128301257	missense	probably damaging	1.00
R1775:Lct	UTSW	1	128300301	missense	probably damaging	1.00
R1792:Lct	UTSW	1	128327942	missense	possibly damaging	0.54
R1815:Lct	UTSW	1	128300159	missense	probably damaging	1.00
R1932:Lct	UTSW	1	128294161	missense	probably damaging	1.00
R2325:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R2381:Lct	UTSW	1	128304121	nonsense	probably null
R3001:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3002:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3003:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3011:Lct	UTSW	1	128301372	missense	possibly damaging	0.74
R3082:Lct	UTSW	1	128287608	missense	probably damaging	1.00
R3683:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3684:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3726:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3886:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3887:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3888:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4019:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4027:Lct	UTSW	1	128285181	missense	probably benign	0.00
R4226:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4409:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4514:Lct	UTSW	1	128300514	missense	probably benign
R4570:Lct	UTSW	1	128299904	missense	probably benign	0.01
R4776:Lct	UTSW	1	128300387	missense	probably damaging	0.99
R5001:Lct	UTSW	1	128308241	missense	probably damaging	0.96
R5021:Lct	UTSW	1	128300565	missense	probably benign	0.38
R5318:Lct	UTSW	1	128304372	missense	probably damaging	1.00
R5330:Lct	UTSW	1	128298529	missense	probably benign	0.06
R5385:Lct	UTSW	1	128311617	missense	possibly damaging	0.63
R5499:Lct	UTSW	1	128286677	missense	probably damaging	1.00
R5508:Lct	UTSW	1	128294131	missense	probably damaging	1.00
R5642:Lct	UTSW	1	128295232	missense	probably damaging	1.00
R5724:Lct	UTSW	1	128300336	missense	probably benign
R6026:Lct	UTSW	1	128300018	missense	probably benign
R6044:Lct	UTSW	1	128307980	missense	possibly damaging	0.95
R6175:Lct	UTSW	1	128327714	missense	probably damaging	1.00
R6277:Lct	UTSW	1	128304237	missense	probably benign	0.01
R6412:Lct	UTSW	1	128327718	missense	probably benign	0.00
R6480:Lct	UTSW	1	128294320	missense	probably damaging	1.00
R6526:Lct	UTSW	1	128300478	missense	probably benign	0.05
R6620:Lct	UTSW	1	128295072	critical splice donor site	probably null
R7214:Lct	UTSW	1	128300460	missense	probably benign	0.00
R7308:Lct	UTSW	1	128319087	missense	probably benign	0.00
R7577:Lct	UTSW	1	128300732	missense	probably damaging	0.99
R7737:Lct	UTSW	1	128298693	missense	probably benign	0.12
R7901:Lct	UTSW	1	128288985	missense	probably benign	0.44
R7984:Lct	UTSW	1	128288985	missense	probably benign	0.44
X0052:Lct	UTSW	1	128307630	missense	probably damaging	1.00
YA93:Lct	UTSW	1	128301320	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGAAATTACCTCCAGCGGTG -3'
(R):5'- AGGACTTTCTCAGAGCAGGC -3'

Sequencing Primer
(F):5'- TTACCTCCAGCGGTGCATAAAG -3'
(R):5'- CTAACAGTGCTAGAGCCTGAGC -3'

Posted On

2019-10-24