Incidental Mutation 'R7626:Kcnj3'
ID589428
Institutional Source Beutler Lab
Gene Symbol Kcnj3
Ensembl Gene ENSMUSG00000026824
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 3
SynonymsGIRK1, Kcnf3, Kir3.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7626 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location55435970-55598145 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 55594821 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 310 (C310*)
Ref Sequence ENSEMBL: ENSMUSP00000063329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067101] [ENSMUST00000112632] [ENSMUST00000112633]
PDB Structure
Crystal Structure of the Cytoplasmic Domain of G-protein Activated Inward Rectifier Potassium Channel 1 [X-RAY DIFFRACTION]
Crystal Structure of Cytoplasmic Domains of GIRK1 channel [X-RAY DIFFRACTION]
Crystal structure of a Kir3.1-prokaryotic Kir channel chimera [X-RAY DIFFRACTION]
Crystal structure of the S225E mutant Kir3.1 cytoplasmic pore domain [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000067101
AA Change: C310*
SMART Domains Protein: ENSMUSP00000063329
Gene: ENSMUSG00000026824
AA Change: C310*

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 385 3.6e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112632
SMART Domains Protein: ENSMUSP00000108251
Gene: ENSMUSG00000026824

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 235 4e-99 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112633
AA Change: C310*
SMART Domains Protein: ENSMUSP00000108252
Gene: ENSMUSG00000026824
AA Change: C310*

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 369 1.1e-141 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and plays an important role in regulating heartbeat. It associates with three other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex that also couples to neurotransmitter receptors in the brain and whereby channel activation can inhibit action potential firing by hyperpolarizing the plasma membrane. These multimeric G-protein-gated inwardly-rectifying potassium (GIRK) channels may play a role in the pathophysiology of epilepsy, addiction, Down's syndrome, ataxia, and Parkinson's disease. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation display slightly increased resting heart rates, and blunted responses to both indirect vagal activation and direct adenosine A1 receptor activation (intended to activate the muscarinic-gated atrial potassium channel). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Kcnj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Kcnj3 APN 2 55595272 missense possibly damaging 0.88
IGL01889:Kcnj3 APN 2 55437204 missense possibly damaging 0.69
IGL01988:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL01989:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL02004:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL02035:Kcnj3 APN 2 55437578 missense probably damaging 1.00
R0268:Kcnj3 UTSW 2 55594959 nonsense probably null
R0565:Kcnj3 UTSW 2 55595264 missense probably benign 0.03
R0853:Kcnj3 UTSW 2 55437223 missense possibly damaging 0.69
R1318:Kcnj3 UTSW 2 55437738 missense possibly damaging 0.88
R1592:Kcnj3 UTSW 2 55437886 missense probably damaging 1.00
R1756:Kcnj3 UTSW 2 55437220 missense probably damaging 1.00
R1899:Kcnj3 UTSW 2 55437244 missense probably damaging 1.00
R1966:Kcnj3 UTSW 2 55437331 missense probably damaging 0.99
R2891:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R2892:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R2893:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R3901:Kcnj3 UTSW 2 55437348 missense possibly damaging 0.46
R4470:Kcnj3 UTSW 2 55437865 missense probably damaging 1.00
R4603:Kcnj3 UTSW 2 55446979 nonsense probably null
R4694:Kcnj3 UTSW 2 55594906 missense probably benign 0.00
R4945:Kcnj3 UTSW 2 55437578 missense probably damaging 1.00
R5144:Kcnj3 UTSW 2 55447047 splice site probably null
R5332:Kcnj3 UTSW 2 55437547 missense probably damaging 1.00
R5959:Kcnj3 UTSW 2 55437318 missense probably benign 0.10
R6352:Kcnj3 UTSW 2 55437549 missense probably benign 0.06
R7042:Kcnj3 UTSW 2 55594865 missense possibly damaging 0.87
R7475:Kcnj3 UTSW 2 55437326 missense probably benign 0.09
R7771:Kcnj3 UTSW 2 55446937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGTTTCCTCGTATAGACAAG -3'
(R):5'- TGAGAAGCATTTCCTCCTGC -3'

Sequencing Primer
(F):5'- GGAGCATTTCCAGCACCTTGTG -3'
(R):5'- CTGCTCTTTCACGCTGTAAGGAG -3'
Posted On2019-10-24