Mutagenetix > Incidental Mutation

Incidental Mutation 'R7626:Cntfr'

589431

Institutional Source

Beutler Lab

Gene Symbol

Cntfr

Ensembl Gene

ENSMUSG00000028444

Gene Name

ciliary neurotrophic factor receptor

Synonyms

Cntfralpha

MMRRC Submission

045690-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7626 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41657498-41697089 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41662013 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 243 (F243S)

Ref Sequence

ENSEMBL: ENSMUSP00000100026 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102961] [ENSMUST00000102962]

AlphaFold

O88507

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102961
AA Change: F243S

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000100026
Gene: ENSMUSG00000028444
AA Change: F243S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	37	96	1.87e-12	SMART
Blast:FN3	106	190	8e-37	BLAST
FN3	204	290	1.1e-7	SMART
low complexity region	309	332	N/A	INTRINSIC
low complexity region	356	371	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102962
AA Change: F243S

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000100027
Gene: ENSMUSG00000028444
AA Change: F243S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	37	96	1.87e-12	SMART
Blast:FN3	106	190	8e-37	BLAST
FN3	204	290	1.1e-7	SMART
low complexity region	309	332	N/A	INTRINSIC
low complexity region	356	371	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: This gene encodes the alpha subunit of the ciliary neurotrophic factor (CNTF) receptor that triggers the assembly of a trimolecular complex upon binding to CNTF, and initiate a downstream signaling process. The encoded preproprotein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-linked cell surface protein. Mice lacking the encoded protein die shortly after birth and exhibit a reduction of motoneuron number at birth. The transgenic disruption of this gene specifically in the skeletal muscle followed by a peripheral nerve lesion impairs motor neuron axonal regeneration across the lesion site. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant animals exhibit a significant reduction in the number of motor neurons. Neonatal mutants fail to suckle and die within 24 hours after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta2	G	A	19: 34,229,931 (GRCm39)	T8I	probably benign	Het
Alox5	T	C	6: 116,390,756 (GRCm39)	D465G	possibly damaging	Het
Arhgef16	T	A	4: 154,367,339 (GRCm39)	K355N	possibly damaging	Het
Camkk2	T	A	5: 122,902,363 (GRCm39)		probably benign	Het
Ccdc171	C	T	4: 83,499,012 (GRCm39)	Q237*	probably null	Het
Ces2b	T	C	8: 105,564,017 (GRCm39)	Y464H	possibly damaging	Het
Crip3	A	T	17: 46,740,791 (GRCm39)	R65S	probably benign	Het
Dcn	A	G	10: 97,319,340 (GRCm39)	Y39C	possibly damaging	Het
Degs2	T	C	12: 108,658,332 (GRCm39)	S216G	possibly damaging	Het
Dmxl1	A	G	18: 50,035,861 (GRCm39)	I2295V	probably benign	Het
Dnah2	A	G	11: 69,389,511 (GRCm39)	S794P	probably damaging	Het
Eri1	A	C	8: 35,941,554 (GRCm39)	Y264*	probably null	Het
Etl4	T	C	2: 20,718,189 (GRCm39)	L179P	probably damaging	Het
F5	T	G	1: 164,014,481 (GRCm39)	M584R	possibly damaging	Het
Fam98c	G	T	7: 28,852,248 (GRCm39)	R104S	probably damaging	Het
Flad1	A	T	3: 89,310,718 (GRCm39)	I443N	probably benign	Het
Hbp1	T	C	12: 31,993,899 (GRCm39)	E43G	probably benign	Het
Hivep3	CGG	CG	4: 119,955,108 (GRCm39)	1141	probably null	Het
Kcnj3	T	A	2: 55,484,833 (GRCm39)	C310*	probably null	Het
Lct	T	C	1: 128,212,932 (GRCm39)	Y1907C	probably damaging	Het
Loxhd1	T	C	18: 77,518,882 (GRCm39)	V1896A	possibly damaging	Het
Lrfn4	C	A	19: 4,663,679 (GRCm39)	R285L	probably damaging	Het
Ltb4r2	T	A	14: 56,000,338 (GRCm39)	S320T	probably damaging	Het
Mmd	G	T	11: 90,148,378 (GRCm39)	R20L	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083 (GRCm38)		probably null	Het
Nbas	T	C	12: 13,608,661 (GRCm39)	S2146P	probably benign	Het
Nop14	A	G	5: 34,809,135 (GRCm39)	F319L	probably damaging	Het
Numa1	C	A	7: 101,648,630 (GRCm39)	T787K	probably benign	Het
Or10q12	T	G	19: 13,745,709 (GRCm39)	M1R	probably null	Het
Or2t46	A	C	11: 58,471,999 (GRCm39)	T110P	probably damaging	Het
Or6c208	T	G	10: 129,223,726 (GRCm39)	C75G	possibly damaging	Het
Patj	T	C	4: 98,435,224 (GRCm39)	V2A	probably benign	Het
Pisd	T	C	5: 32,898,032 (GRCm39)	H52R	probably benign	Het
Plekhg6	A	T	6: 125,340,631 (GRCm39)	D576E	probably benign	Het
Plekhn1	T	A	4: 156,310,110 (GRCm39)	H68L	probably benign	Het
Ppp1r37	T	A	7: 19,295,778 (GRCm39)	I60F	probably damaging	Het
Ppp2r1b	C	T	9: 50,789,476 (GRCm39)	T513M	possibly damaging	Het
Pramel32	A	T	4: 88,548,279 (GRCm39)	I42N	probably damaging	Het
Rhobtb2	C	A	14: 70,034,386 (GRCm39)	A280S	probably damaging	Het
Rnf40	A	G	7: 127,189,047 (GRCm39)	D140G	probably benign	Het
Rxfp1	A	G	3: 79,555,397 (GRCm39)	L653P	probably damaging	Het
Satb1	A	T	17: 52,074,995 (GRCm39)	D500E	probably benign	Het
Slc15a1	A	T	14: 121,713,377 (GRCm39)	D383E	probably benign	Het
Smarcad1	C	A	6: 65,073,033 (GRCm39)	S604R	possibly damaging	Het
St7	A	G	6: 17,934,216 (GRCm39)	T533A	probably damaging	Het
Sv2c	T	A	13: 96,122,451 (GRCm39)	T442S	probably benign	Het
Tbx2	A	G	11: 85,731,622 (GRCm39)	T640A	probably benign	Het
Tenm4	T	A	7: 96,542,221 (GRCm39)	N1948K	probably damaging	Het
Tll1	T	C	8: 64,551,268 (GRCm39)		probably null	Het
Tmem135	A	T	7: 88,805,718 (GRCm39)		probably null	Het
Tonsl	A	T	15: 76,518,136 (GRCm39)	L582Q	probably null	Het
Unc13c	T	A	9: 73,641,799 (GRCm39)	K1231N	probably damaging	Het
Vmn2r101	T	A	17: 19,832,192 (GRCm39)	Y729*	probably null	Het
Zcchc2	A	G	1: 105,928,742 (GRCm39)	T334A	possibly damaging	Het
Zfp655	T	C	5: 145,173,917 (GRCm39)	L136P	probably damaging	Het
Zfp729a	A	T	13: 67,768,437 (GRCm39)	C597*	probably null	Het

Other mutations in Cntfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1215:Cntfr	UTSW	4	41,662,064 (GRCm39)	missense	probably damaging	1.00
R1635:Cntfr	UTSW	4	41,658,816 (GRCm39)	missense	probably damaging	1.00
R1795:Cntfr	UTSW	4	41,670,841 (GRCm39)	critical splice donor site	probably null
R2115:Cntfr	UTSW	4	41,663,534 (GRCm39)	splice site	probably null
R2437:Cntfr	UTSW	4	41,671,035 (GRCm39)	missense	probably damaging	0.99
R4056:Cntfr	UTSW	4	41,658,900 (GRCm39)	missense	probably damaging	0.99
R4770:Cntfr	UTSW	4	41,663,282 (GRCm39)	missense	possibly damaging	0.57
R5245:Cntfr	UTSW	4	41,670,879 (GRCm39)	missense	possibly damaging	0.92
R5346:Cntfr	UTSW	4	41,675,042 (GRCm39)	nonsense	probably null
R5436:Cntfr	UTSW	4	41,663,322 (GRCm39)	missense	probably damaging	0.98
R5535:Cntfr	UTSW	4	41,663,216 (GRCm39)	missense	probably benign	0.44
R6275:Cntfr	UTSW	4	41,663,216 (GRCm39)	missense	possibly damaging	0.89
R6749:Cntfr	UTSW	4	41,663,232 (GRCm39)	missense	possibly damaging	0.47
R9006:Cntfr	UTSW	4	41,661,971 (GRCm39)	critical splice donor site	probably null
R9524:Cntfr	UTSW	4	41,661,995 (GRCm39)	missense	probably damaging	1.00
R9736:Cntfr	UTSW	4	41,658,290 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCAGTATTCTGATGAGGGTGCC -3'
(R):5'- GGTTGTTCCAGAGCACACTG -3'

Sequencing Primer
(F):5'- AACCCACGGGATGCCTTC -3'
(R):5'- GAGCACACTGATGAAGCTATGTTTCC -3'

Posted On

2019-10-24