Incidental Mutation 'R7626:Pisd'
ID589438
Institutional Source Beutler Lab
Gene Symbol Pisd
Ensembl Gene ENSMUSG00000023452
Gene Namephosphatidylserine decarboxylase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7626 (G1)
Quality Score152.008
Status Not validated
Chromosome5
Chromosomal Location32736301-32785646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32740688 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 52 (H52R)
Ref Sequence ENSEMBL: ENSMUSP00000120201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061895] [ENSMUST00000071829] [ENSMUST00000120591] [ENSMUST00000135248] [ENSMUST00000142957] [ENSMUST00000144673] [ENSMUST00000197787] [ENSMUST00000200390] [ENSMUST00000202283]
Predicted Effect probably benign
Transcript: ENSMUST00000061895
SMART Domains Protein: ENSMUSP00000051438
Gene: ENSMUSG00000023452

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 162 405 1.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071829
AA Change: H52R

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071732
Gene: ENSMUSG00000023452
AA Change: H52R

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 131 260 3.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120591
AA Change: H52R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112573
Gene: ENSMUSG00000023452
AA Change: H52R

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 131 374 1.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135248
AA Change: H52R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000142779
SMART Domains Protein: ENSMUSP00000122705
Gene: ENSMUSG00000023452

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 153 270 1.7e-33 PFAM
Pfam:PS_Dcarbxylase 268 358 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142957
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197787
Predicted Effect probably benign
Transcript: ENSMUST00000200390
AA Change: H52R

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000202283
AA Change: H52R

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of phosphatidylserine to phosphatidylethanolamine in the inner mitochondrial membrane. The encoded protein is active in phospholipid metabolism and interorganelle trafficking of phosphatidylserine. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryogenesis defects such as abnormal trophoblast development, abnormal extraembronic tissue morphology and abnormal mitochondrial morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Pisd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Pisd APN 5 32738412 missense probably benign 0.02
IGL00540:Pisd APN 5 32738412 missense probably benign 0.02
IGL00577:Pisd APN 5 32738412 missense probably benign 0.02
IGL00580:Pisd APN 5 32738412 missense probably benign 0.02
IGL00590:Pisd APN 5 32738412 missense probably benign 0.02
IGL00990:Pisd APN 5 32739358 missense probably benign 0.24
IGL01899:Pisd APN 5 32739132 splice site probably null
IGL01908:Pisd APN 5 32739132 splice site probably null
IGL01928:Pisd APN 5 32739132 splice site probably null
IGL01931:Pisd APN 5 32739132 splice site probably null
IGL01935:Pisd APN 5 32739132 splice site probably null
IGL01948:Pisd APN 5 32739132 splice site probably null
IGL01952:Pisd APN 5 32739132 splice site probably null
IGL02195:Pisd APN 5 32737315 missense probably damaging 1.00
shandong UTSW 5 32764796 missense possibly damaging 0.94
R0674:Pisd UTSW 5 32774437 missense probably benign 0.00
R0840:Pisd UTSW 5 32737312 missense probably damaging 1.00
R1976:Pisd UTSW 5 32738865 missense probably damaging 1.00
R1986:Pisd UTSW 5 32737328 missense probably damaging 1.00
R2044:Pisd UTSW 5 32764796 missense possibly damaging 0.94
R5705:Pisd UTSW 5 32737363 missense probably benign 0.14
R5756:Pisd UTSW 5 32738498 missense probably damaging 1.00
R6249:Pisd UTSW 5 32738844 missense probably damaging 1.00
R6389:Pisd UTSW 5 32764847 missense probably damaging 1.00
R6913:Pisd UTSW 5 32737429 missense probably damaging 1.00
R7143:Pisd UTSW 5 32738502 missense possibly damaging 0.73
R7571:Pisd UTSW 5 32737337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATATTTACTCATGAGTGCGGTC -3'
(R):5'- TGCCTGCTGGAACTCTTTGG -3'

Sequencing Primer
(F):5'- ACTCATGAGTGCGGTCTCTGATAAG -3'
(R):5'- AACTCTTTGGTTCCATTGGAGAGAG -3'
Posted On2019-10-24