Incidental Mutation 'R7626:Nop14'
ID589439
Institutional Source Beutler Lab
Gene Symbol Nop14
Ensembl Gene ENSMUSG00000036693
Gene NameNOP14 nucleolar protein
SynonymsNol14, 2610033H07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7626 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location34638536-34660148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34651791 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 319 (F319L)
Ref Sequence ENSEMBL: ENSMUSP00000038382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041364]
Predicted Effect probably damaging
Transcript: ENSMUST00000041364
AA Change: F319L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038382
Gene: ENSMUSG00000036693
AA Change: F319L

DomainStartEndE-ValueType
Pfam:Nop14 21 849 2.2e-273 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201897
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in pre-18s rRNA processing and small ribosomal subunit assembly. The encoded protein may be involved in the regulation of pancreatic cancer cell proliferation and migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Nop14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Nop14 APN 5 34641313 unclassified probably benign
IGL00985:Nop14 APN 5 34644789 missense probably damaging 0.98
IGL01626:Nop14 APN 5 34649345 nonsense probably null
IGL02676:Nop14 APN 5 34639221 missense probably damaging 0.97
IGL03189:Nop14 APN 5 34650628 unclassified probably benign
IGL03047:Nop14 UTSW 5 34660014 missense possibly damaging 0.93
R0025:Nop14 UTSW 5 34643953 missense probably benign 0.08
R0831:Nop14 UTSW 5 34650520 missense possibly damaging 0.70
R1027:Nop14 UTSW 5 34644004 missense probably damaging 0.99
R1252:Nop14 UTSW 5 34650555 missense probably benign
R1616:Nop14 UTSW 5 34650413 missense possibly damaging 0.46
R1845:Nop14 UTSW 5 34650328 missense possibly damaging 0.82
R2032:Nop14 UTSW 5 34659939 missense possibly damaging 0.65
R3693:Nop14 UTSW 5 34654438 missense probably damaging 0.98
R4033:Nop14 UTSW 5 34650517 missense probably benign
R4168:Nop14 UTSW 5 34656744 missense probably damaging 0.99
R4172:Nop14 UTSW 5 34650607 missense probably damaging 0.99
R4618:Nop14 UTSW 5 34639218 missense probably damaging 1.00
R4936:Nop14 UTSW 5 34652393 missense probably damaging 1.00
R6067:Nop14 UTSW 5 34657951 missense probably damaging 1.00
R6075:Nop14 UTSW 5 34659891 missense probably damaging 1.00
R6078:Nop14 UTSW 5 34657951 missense probably damaging 1.00
R6284:Nop14 UTSW 5 34641491 unclassified probably null
R7295:Nop14 UTSW 5 34639032 missense probably damaging 0.99
R7585:Nop14 UTSW 5 34644780 missense probably damaging 1.00
U15987:Nop14 UTSW 5 34657951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGACCTGCTCATGTAAATG -3'
(R):5'- AGGCCTCTTCAGTACCTCAG -3'

Sequencing Primer
(F):5'- AACTGCAAGTTCTAAGGGGTCTC -3'
(R):5'- ACCTCAGTGTCTGCAGAGATTTGAC -3'
Posted On2019-10-24