Incidental Mutation 'R7626:Camkk2'
ID589440
Institutional Source Beutler Lab
Gene Symbol Camkk2
Ensembl Gene ENSMUSG00000029471
Gene Namecalcium/calmodulin-dependent protein kinase kinase 2, beta
Synonyms6330570N16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R7626 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location122731170-122779409 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 122764300 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111668] [ENSMUST00000196742] [ENSMUST00000198257] [ENSMUST00000199599] [ENSMUST00000200109]
Predicted Effect probably benign
Transcript: ENSMUST00000111668
SMART Domains Protein: ENSMUSP00000107297
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196742
SMART Domains Protein: ENSMUSP00000142812
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
Pfam:Pkinase 165 206 1.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198257
SMART Domains Protein: ENSMUSP00000143162
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 27 47 N/A INTRINSIC
Pfam:Pkinase 68 109 3.9e-5 PFAM
low complexity region 111 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199179
Predicted Effect probably benign
Transcript: ENSMUST00000199599
Predicted Effect probably benign
Transcript: ENSMUST00000200109
SMART Domains Protein: ENSMUSP00000143732
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the Serine/Threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. The major isoform of this gene plays a role in the calcium/calmodulin-dependent (CaM) kinase cascade by phosphorylating the downstream kinases CaMK1 and CaMK4. Protein products of this gene also phosphorylate AMP-activated protein kinase (AMPK). This gene has its strongest expression in the brain and influences signalling cascades involved with learning and memory, neuronal differentiation and migration, neurite outgrowth, and synapse formation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. The identified isoforms differ in their ability to undergo autophosphorylation and to phosphorylate downstream kinases. [provided by RefSeq, Jul 2012]
PHENOTYPE: Inactivation of this locus results in impaird long term potentiation and defects in some types of long term memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Camkk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Camkk2 APN 5 122763950 missense probably damaging 1.00
IGL02321:Camkk2 APN 5 122764127 missense probably damaging 0.96
IGL02619:Camkk2 APN 5 122764235 missense probably damaging 0.98
IGL03356:Camkk2 APN 5 122743874 missense probably damaging 1.00
R0056:Camkk2 UTSW 5 122742198 missense probably damaging 1.00
R0078:Camkk2 UTSW 5 122757559 critical splice donor site probably null
R0344:Camkk2 UTSW 5 122763877 missense probably benign
R1480:Camkk2 UTSW 5 122734278 intron probably null
R1591:Camkk2 UTSW 5 122757558 critical splice donor site probably null
R1816:Camkk2 UTSW 5 122734180 missense probably damaging 1.00
R1960:Camkk2 UTSW 5 122737512 nonsense probably null
R1985:Camkk2 UTSW 5 122764127 missense possibly damaging 0.81
R2256:Camkk2 UTSW 5 122746335 missense probably damaging 1.00
R4297:Camkk2 UTSW 5 122745706 critical splice donor site probably null
R4687:Camkk2 UTSW 5 122753724 missense probably damaging 1.00
R5401:Camkk2 UTSW 5 122746335 missense probably damaging 1.00
R5802:Camkk2 UTSW 5 122734244 missense probably damaging 0.99
R6167:Camkk2 UTSW 5 122764124 missense probably damaging 0.96
R6508:Camkk2 UTSW 5 122746319 missense probably damaging 0.96
R7313:Camkk2 UTSW 5 122737511 missense possibly damaging 0.55
R7504:Camkk2 UTSW 5 122746308 missense probably damaging 1.00
R7664:Camkk2 UTSW 5 122756582 missense unknown
R7698:Camkk2 UTSW 5 122746419 missense probably damaging 0.96
R7805:Camkk2 UTSW 5 122742212 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTAAGGATGAGAGTCCCCGC -3'
(R):5'- ACACTGGGCTGTAAGCTGTTC -3'

Sequencing Primer
(F):5'- ATGAGAGTCCCCGCAGTGC -3'
(R):5'- TTTGAACTCAGGACCTCTGGAAG -3'
Posted On2019-10-24