Incidental Mutation 'R7626:Zfp655'
ID589441
Institutional Source Beutler Lab
Gene Symbol Zfp655
Ensembl Gene ENSMUSG00000007812
Gene Namezinc finger protein 655
Synonyms9030409O18Rik, 2700038I16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145231715-145247302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145237107 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 136 (L136P)
Ref Sequence ENSEMBL: ENSMUSP00000143198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085661] [ENSMUST00000167316] [ENSMUST00000196069] [ENSMUST00000199003] [ENSMUST00000199322] [ENSMUST00000200039]
Predicted Effect silent
Transcript: ENSMUST00000085661
SMART Domains Protein: ENSMUSP00000082803
Gene: ENSMUSG00000007812

DomainStartEndE-ValueType
KRAB 77 138 2.14e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167316
SMART Domains Protein: ENSMUSP00000128969
Gene: ENSMUSG00000007812

DomainStartEndE-ValueType
ZnF_C2H2 243 265 5.29e-5 SMART
ZnF_C2H2 271 293 2.99e-4 SMART
ZnF_C2H2 299 328 1.38e2 SMART
ZnF_C2H2 334 356 6.78e-3 SMART
ZnF_C2H2 361 383 3.99e0 SMART
ZnF_C2H2 411 433 3.63e-3 SMART
ZnF_C2H2 439 461 1.01e-1 SMART
low complexity region 463 475 N/A INTRINSIC
ZnF_C2H2 495 517 6.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196069
Predicted Effect unknown
Transcript: ENSMUST00000199003
AA Change: L65P
SMART Domains Protein: ENSMUSP00000142825
Gene: ENSMUSG00000007812
AA Change: L65P

DomainStartEndE-ValueType
Blast:KRAB 26 67 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199322
Predicted Effect probably damaging
Transcript: ENSMUST00000200039
AA Change: L136P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143198
Gene: ENSMUSG00000007812
AA Change: L136P

DomainStartEndE-ValueType
KRAB 77 138 2.14e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein. The zinc finger proteins are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Zfp655
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Zfp655 APN 5 145244145 missense probably damaging 1.00
IGL01679:Zfp655 APN 5 145243827 missense probably damaging 0.96
IGL02379:Zfp655 APN 5 145243955 missense probably benign 0.13
IGL02647:Zfp655 APN 5 145243006 missense probably benign
R0104:Zfp655 UTSW 5 145244015 missense probably damaging 1.00
R0104:Zfp655 UTSW 5 145244015 missense probably damaging 1.00
R0270:Zfp655 UTSW 5 145244457 missense probably damaging 1.00
R0608:Zfp655 UTSW 5 145244057 missense possibly damaging 0.57
R1528:Zfp655 UTSW 5 145244601 missense probably damaging 0.98
R2076:Zfp655 UTSW 5 145244600 missense possibly damaging 0.89
R2119:Zfp655 UTSW 5 145244784 missense probably damaging 0.98
R2375:Zfp655 UTSW 5 145244396 missense probably benign 0.10
R2403:Zfp655 UTSW 5 145244546 missense probably benign 0.00
R4032:Zfp655 UTSW 5 145244048 missense possibly damaging 0.50
R4532:Zfp655 UTSW 5 145244697 missense probably benign 0.06
R4880:Zfp655 UTSW 5 145244358 missense probably damaging 0.99
R5484:Zfp655 UTSW 5 145243635 missense probably benign 0.01
R5529:Zfp655 UTSW 5 145244736 missense probably damaging 0.96
R6193:Zfp655 UTSW 5 145244776 missense probably benign 0.03
R6195:Zfp655 UTSW 5 145243762 missense possibly damaging 0.52
R7050:Zfp655 UTSW 5 145244735 missense probably benign 0.12
R7471:Zfp655 UTSW 5 145244732 missense possibly damaging 0.80
R7612:Zfp655 UTSW 5 145237189 missense unknown
R7989:Zfp655 UTSW 5 145244570 missense probably damaging 1.00
R8557:Zfp655 UTSW 5 145244025 missense probably benign 0.37
R8805:Zfp655 UTSW 5 145244480 missense probably damaging 1.00
Z1176:Zfp655 UTSW 5 145244003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTCTCCTTGAGCTTTGTC -3'
(R):5'- ATGGTGGCATCCCAAGGAAC -3'

Sequencing Primer
(F):5'- AGCCTGTCTTTGATCTTGCATACAC -3'
(R):5'- GTGGCATCCCAAGGAACATATGTTC -3'
Posted On2019-10-24