Incidental Mutation 'R7626:Zfp655'
ID589441
Institutional Source Beutler Lab
Gene Symbol Zfp655
Ensembl Gene ENSMUSG00000007812
Gene Namezinc finger protein 655
Synonyms9030409O18Rik, 2700038I16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145231715-145247302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145237107 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 136 (L136P)
Ref Sequence ENSEMBL: ENSMUSP00000143198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085661] [ENSMUST00000167316] [ENSMUST00000196069] [ENSMUST00000199003] [ENSMUST00000199322] [ENSMUST00000200039]
Predicted Effect silent
Transcript: ENSMUST00000085661
SMART Domains Protein: ENSMUSP00000082803
Gene: ENSMUSG00000007812

DomainStartEndE-ValueType
KRAB 77 138 2.14e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167316
SMART Domains Protein: ENSMUSP00000128969
Gene: ENSMUSG00000007812

DomainStartEndE-ValueType
ZnF_C2H2 243 265 5.29e-5 SMART
ZnF_C2H2 271 293 2.99e-4 SMART
ZnF_C2H2 299 328 1.38e2 SMART
ZnF_C2H2 334 356 6.78e-3 SMART
ZnF_C2H2 361 383 3.99e0 SMART
ZnF_C2H2 411 433 3.63e-3 SMART
ZnF_C2H2 439 461 1.01e-1 SMART
low complexity region 463 475 N/A INTRINSIC
ZnF_C2H2 495 517 6.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196069
Predicted Effect unknown
Transcript: ENSMUST00000199003
AA Change: L65P
SMART Domains Protein: ENSMUSP00000142825
Gene: ENSMUSG00000007812
AA Change: L65P

DomainStartEndE-ValueType
Blast:KRAB 26 67 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199322
Predicted Effect probably damaging
Transcript: ENSMUST00000200039
AA Change: L136P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143198
Gene: ENSMUSG00000007812
AA Change: L136P

DomainStartEndE-ValueType
KRAB 77 138 2.14e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein. The zinc finger proteins are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Zfp655
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Zfp655 APN 5 145244145 missense probably damaging 1.00
IGL01679:Zfp655 APN 5 145243827 missense probably damaging 0.96
IGL02379:Zfp655 APN 5 145243955 missense probably benign 0.13
IGL02647:Zfp655 APN 5 145243006 missense probably benign
R0104:Zfp655 UTSW 5 145244015 missense probably damaging 1.00
R0104:Zfp655 UTSW 5 145244015 missense probably damaging 1.00
R0270:Zfp655 UTSW 5 145244457 missense probably damaging 1.00
R0608:Zfp655 UTSW 5 145244057 missense possibly damaging 0.57
R1528:Zfp655 UTSW 5 145244601 missense probably damaging 0.98
R2076:Zfp655 UTSW 5 145244600 missense possibly damaging 0.89
R2119:Zfp655 UTSW 5 145244784 missense probably damaging 0.98
R2375:Zfp655 UTSW 5 145244396 missense probably benign 0.10
R2403:Zfp655 UTSW 5 145244546 missense probably benign 0.00
R4032:Zfp655 UTSW 5 145244048 missense possibly damaging 0.50
R4532:Zfp655 UTSW 5 145244697 missense probably benign 0.06
R4880:Zfp655 UTSW 5 145244358 missense probably damaging 0.99
R5484:Zfp655 UTSW 5 145243635 missense probably benign 0.01
R5529:Zfp655 UTSW 5 145244736 missense probably damaging 0.96
R6193:Zfp655 UTSW 5 145244776 missense probably benign 0.03
R6195:Zfp655 UTSW 5 145243762 missense possibly damaging 0.52
R7050:Zfp655 UTSW 5 145244735 missense probably benign 0.12
R7471:Zfp655 UTSW 5 145244732 missense possibly damaging 0.80
R7612:Zfp655 UTSW 5 145237189 missense unknown
Z1176:Zfp655 UTSW 5 145244003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTCTCCTTGAGCTTTGTC -3'
(R):5'- ATGGTGGCATCCCAAGGAAC -3'

Sequencing Primer
(F):5'- AGCCTGTCTTTGATCTTGCATACAC -3'
(R):5'- GTGGCATCCCAAGGAACATATGTTC -3'
Posted On2019-10-24